Transcript asmbl_36855

Sequence
Transcript Sequence for observation asmbl_36855 of TGE0060202:
GGCGTCACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGGAACCATGGCGTCCCTTTCCCTTGCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGAGCAGAGACAGCTCGTCTGACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAGAGCACCTTGGGACCCAAAGGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCTCTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCAGCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACCTCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAGATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCGCTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATGAATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACAAAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCATATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTGGATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCAAATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCTACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAACGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCTGAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTGGAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTGGTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATTCACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAACAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACTGTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCTGTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCTAAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGACCTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATGAGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAGCGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATCATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACCCCTGTTAAGCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAGCAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTGGAATCTGTTTATCGGTGCCCATTATATCCTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATTTGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAACAATTACTTGG