Transcript asmbl_30251

Sequence
Transcript Sequence for observation asmbl_30251 of TGE0004737:
CGGGGCTTGGAAGAGGCGGGCTCCCAGGGAAAAGCCAGTGTCCTCCCCAGCCTAAGGCCGCGGCGACCGAGCCAGGCGAAGGGACCGGGGTACCCCTCACCCTCCAGGAGCTCTAGAGACCCAGGACCATGGACAATTTCAATAGGAACCAGGTAGGCCCTGGATGCAAGACCCAAGTAATGGTGCAGAAAGGACCATTGGACCTGATTGAGACAGGCAAAGGGCTGAAAGTACAAACAGACAAACCCCATCTGGTGAGCCTGGGCAGTGGGCGACTCAGCACAGCTATCACCTTTCTGCCGCTGGAAGAAGGGAGGACAGTGATTGGCTCTGCAGCCAAGGACATCTCACTGCAGGGTCCAGGCCTGGCTCCAGAGCACTGCTACATCGAGAACCTGCGGGGCACCCTCACCCTCTACCCTTGTGGTAATGCCTGTGCTATTGATGGACTCCCTGTTCGACAGCCCACCCGGCTCACTCAGGGCTGTATGTTGTGCCTGGGTCAATCTACCTTCCTCCGCTTTAACCACCCGGCTGAAGCCAAGTGGATGAAAAGCATGATTCCTGCCGGGGGCCGTACTCCTGGGTCTCCGTACAGTCCTGGCCCAGAATCAGAAAGCCTGGTGAATGGGAACCATACCCCACAGCCTGCAACTCGGGGACCCTCTGCCTGTGCCAGCCACAGTTCCCTGGTGAGCTCAATTGAGAAGGACCTGCAAGAAATCATGGATTCACTGGTGCTAGAGGAACCTGGAGCTGCTGGCAAGAAGCCTGCCACAACTTCCCCACTGTCGCCGATGACTAATGGTGGTCGTTACCTGCTGTCCCCCCCAACCAGCCCTGGTGCCATGTCTGTGGGTTCCAGCTATGAGAACACCTCTCCAGCCTTCTCTCCACTCTCCTCACCAGCCAGCAGTGGAAGCTGTGCCAGCCACTCACCCAGTGGGCAGGAGCCAGCATCTTCCACACCCCCACTAGTGCCTGCCCGTTCCTCTAGCTACCATCTGGCCCTGCAGCCCCCACAGTCCCGACCTAGTGGTGCCCGCTCCTCTGAGAGCCCCCGGCTGGGCAGGAAAGGGGTTCATGAGAGGCCTCCCAGCCCTGGCCTCCGGGGTCTGCTGACAGACAGCCCTGCATCTACTGTCTTGGCGGAGGCCCGCAGAACCACTGAGAGCCCCCGGCTATGTGGGCAGCTGCCTCTGGTGGCTATCAATCTGAGTGAATACTCGGCTTCTGGTGCCCACAGTCAACCCACCAGCATTCCTGGCAGTCCCAAGTTCCAGTCTCCAGTCCCTGCTCCCCGAAACAAGATTGGCACACTTCAGGACCGCCCTCCCAGCCCTTTCCGTGAGCTTCCAGGCGCTGAGCGGGTATTGACAACCAGCCCCTCACGCCAGCTGGTGGGCCGAACATTTTCAGATGGTTCAGCTACCCGCACCCTGCAGCCTCCTGAAAGCCCCTGCCTGGGCCGACGGGGCCTGGACAGTATGCGAGAACTCCCTCCCTTGAGCCCGTCTCTGTCCAGACGAGCTCTCTCCCCCATGCCCTCCCGGAATACTCCAGATCCCAAACTAACTAGGGAAGTGGCAGAGAGTCCCCGGCCGCGGCGCTGGGCAGCCCATGGGACTTCACCAGAGGACTTCTCCCTGACACTGGGGTCGCGGGGCCGGAGGACACGGAGCCCCTCACCCACACTCGGGGAGTCCCTGGCACCCAGCAAGGGCAGCTTCAGTGGCAGGCTGAGCCCAGCTTACAGTTTGGGCTCTTTGACTGGGGCTTCGCCCCGTCAGAGCCCCCGTGCCCAGAGGAAACTCTCCAGCGGGGACTTACGGGTGCCTGTCACTCGAGAGAGGAAAAATAGCATCACGGAGATCAGTGACAATGAGGATGACCTCCTGGAGTACCACCGGCGGCAGCGCCAAGAACGGCTTCGGGAGCAGGAGATGGAGAGGCTGGAACGCCAGCGCCTGGAGACCATCCTGAATCTGTGTGCCGAGTACAGCCGGGCTGATGGGGGACCTGAGGCCGGAGAGCTGCTCAGCATTGGGGAGGCCACTGCAGCATTGGCACTGGCAGGCCGGAGGCCCTCACGAGGCCTTTCAGGAACCACTGGGGCCTCTGGGCGGAACAATGAGGAGCCTGGAAGTGCCACCCAACGCCTGTGGGAGAGTGTAGAACGCTCAGATGAGGAAAATCTCAAGGAGGAGTGCAGTAGCACTGAGAGCACCCAGCAGGAGCACGAAGATGCACCTAACACCAAGCTCCAGGGAGAAGTGTTGGCCCTGGAAGATGAACGGGCTCAGGTGCTAGGGCGAGTGGAGCAGCTCAAGGTCCATGTGAAGGAGCTGGAGCAGCAGCTGCAGGAGTCAGCTCGAGAGGCTGAAATGGAGCGGGCGCTGCTGCAGGGGGAGAGGGAGGCAGAGCGGGCACTGTTGCAGAAGGAGCAGAAAGCAGTGGACCAGCTGCAGGAGAAGCTGGTGACTTTGGAGACAGGCATCCAAAAGGAGAGGGACAAGGAGGCAGAGGCCTTGGAGACTGAGACAAAGCTCTTTGAGGACTTGGAGTTCCAGCAGCTGGAGCGAGAGAGCCGCGTGGAGGAGGAGCGCGAGCTGGCGGGCCAGGGGCTGCTCAGAAGCAAGGCCGAGCTATTCCGCAGCATCGCCAAGAGGAAGGAGCGGCTGGCAGTCCTGGACAGTCAGGCTGGGCAGATCCGGGCTCAGGCTGTGCAAGAGTCTGAGCGCCTGGCCCGGGACAAGAATGCCTCCCTGCAGCTGCTGCAGAAGGAGAAAGAGAAACTGACTATGTTGGAAAGAAGGTACCACTCACTCACAGGGGGCAGACCTTTTCCAAAGACCACATCAACCCTCAAAGAGAATGCTCCACTCATCCAGAATGGCACAGGCAGCCTTCCTCGCAACCTGGCAGCCACACTGCAGGACATCGAGACCAAGCGCCAACTGGCCCTGCAGCAGAAGGGGCAGCAGGTGATTGAGGAACAGCGGCGGCGATTGGCTGAGCTGAAGCAGAAAGCAGCAGCCGAGGCTCAGTGCCAGTGGGATGCTCTGCACGGGATGGCCCCCTTCCCAGCAGGCCCCTCGGGCTTCCCCCCACTCGTGCACCACTCCATCCTGCATCACCTGCCAGCTGGGCGGGAACGTGGGGAGGAGGGCGAGCACGCCTATGATACACTGAGCCTGGAGAGCTCTGACAGCATGGAGACCAGCATCTCCACAGGAGGCAACTCCGCCTGTTCCCCCGACAACATGTCCAGTGCAAGCGGCCTGGACGTGGGGAAGATCGAGGAGATGGAGAAGATGCTGAAAGAAGCTCATGCAGAGAAAAGCCGACTCATGGAGTCGAGGGAGCGGGAAATGGAGCTGCGGAGGCAGGCACTGGAGGAGGAGCGGAGAAGGAGGGAGCAGGTGGAACGGAGGCTGCAGAGTGAGAGCTCCAGGAGGCAGCAGCTGGTGGAGAAGGAGGTCAAGATGCGGGAGAAACAGTTTTCTCAGGCACGACCTCTGACCCGCTACCTGCCAAACCGGAAGGAGGACTTTGACTTGAAGACCCACATCGAGTCGTCAGGACATGGCGTCGATACCTGCCTGCACGTGGTGCTCAGCAGCAAGGTCTGCCGTGGCTACTTGGTCAAGATGGGCGGCAAGATTAAATCGTGGAAGAAGCGCTGGTTTGTCTTTGACCGGCTCAAGCGCACCCTTTCCTATTATGTGGACAAGCATGAGACAAAACTGAAGGGGGTCATCTATTTCCAGGCCATTGAGGAGGTATACTATGACCACCTGCGCAGTGCAGCCAAGAGCCCAAACCCAGCCCTCACCTTCTGTGTGAAGACCCATGACCGGCTGTACTACATGGTAGCCCCCTCTGCAGAGGCCATGCGCATCTGGATGGATGTCATTGTCACCGGGGCTGAAGGCTACACTCAGTTCATGAACTGACTGGCATGGGCCTTCTGGACCCTCAGGCCAGCCCCAGGACCCATGCCTGACGATGGCTGCTCTCTTTGGCCCTGGAGACAGAGTCACACCCTGGACTCCAGGCCTCACTGGGGCACTCCCAGAGGACCTGGGAGGGCAGAGTGTGCCTGGGGCTTTTGTACAAGACTTTGTAATGTTGTCTAAGGAGCTCATCCTGGGAGTTTCTGAGCTTGGCCCTCTAAAGAACCAGCCAGGAGATAAAAGGTAGGATGGGGCTTTACTGCCTCCTGGGAGCCCAGAACTTGCAATAACTCTTTAGGGTCCTGCCCTCCCTAGCCTGTATTCTCTTTTGTAAAGAACAAATTATGGTACCTGAATCTGCCAAAGATCCCCTCTTGCCTCAGCCCCCTTTGCAGGGGACTTGAGGGATGAGCAGAGCCACATCCAGAGTGGGGTAATAGCTCAGGCAGTATACTTCTCAAACCCTGCTCTACCCAATTATTCTTCTGCAATTATATTTTTTATTACTTTGCTCAAGGGCCAGAGACCTCAAGTGTCATCCTTGAGGTCTCAGTCCCAACCCTTTTTGCAGACCCATTATCATGGTCACCATAGTAACTGCTTCATTGCCATGGTTACATACTAATTGCTGTGGCTCCATGGCTCAGCCCACTGCTTAAGCTGTGGGCCCATCTGAGGGTATGTGCCATCATCTCTCCAGCCCAAGACCTTGGGTATCTTATGCTGGGGGGAAGGGACTGATCACCTCCCTGCCTCCAGCCTGTGTCTCCAGGCTCTGATACACAGCCTGCTGCCCCAAACCCCCTGCCCTGGGCCAGCCCTCTCCCTTCCACTCGTGCCTTGCTTAGAGCCAGAAGGGATGAAGCTGGGGCTTCTAGATCCAGAGGAGGAGCAATGCGAATGGGAGATAAAGCTATAATGGCTGTCCTCAAGATTTCTGGGGCTGAGTTTCTGACAGGGACAGAGGGCTGCTTCCTTGGGAATGTGAGCAGGAGAGGGAACAGCAGAGAGGGAGGAGTCTGAGGTCCAGCTATGCTCCCTTCGGCCTCAGAAGGGCAATGAAAATGAAGAGCAAAGGTCCAGGCCTCCAGCTGTCCAGCCTCAGCCCTTCAAGCCTTAACATTAGCCCACCTCCCTGTCCCCTTTTCCAGCACTGGGACGTGATAGCTGGGCCCAGCTGAGTGATTTTCAGTATTTGTAAGCATCTCAGCAGAACAATAAAGCATTTGGAGTATG