Transcript asmbl_36584

Sequence
Transcript Sequence for observation asmbl_36584 of TGE0056779:
TATAACTCGGGTCGCGCGGCTCGCGCAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGCTTCACCACTCGCTCCACCTTCTCCACCAACTACCGGTCCCTGGGCTCTGTCCAGGCGCCCAGCTACGGCGCCCGGCCGGTCAGCAGCGCGGCCAGCGTCTATGCAGGCGCTGGGGGCTCTGGTTCCCGGATCTCCGTGTCCCGCTCCACCAGCTTCAGGGGCGGCATGGGGTCCGGGGGCCTGGCCACCGGGATAGCCGGGGGTCTGGCAGGAATGGGAGGCATCCAGAACGAGAAGGAGACCATGCAAAGCCTGAACGACCGCCTGGCCTCTTACCTGGACAGAGTGAGGAGCCTGGAGACCGAGAACCGGAGGCTGGAGAGCAAAATCCGGGAGCACTTGGAGAAGAAGGGACCCCAGGTCAGAGACTGGAGCCATTACTTCAAGATCATCGAGGACCTGAGGGCTCAGATCTTCGCAAATACTGTGGACAATGCCCGCATCGTTCTGCAGATTGACAATGCCCGTCTTGCTGCTGATGACTTTAGAGTCAAGTATGAGACAGAGCTGGCCATGCGCCAGTCTGTGGAGAACGACATCCATGGGCTCCGCAAGGTCATTGATGACACCAATATCACACGACTGCAGCTGGAGACAGAGATCGAGGCTCTCAAGGAGGAGCTGCTCTTCATGAAGAAGAACCACGAAGAGGAAGTAAAAGGCCTACAAGCCCAGATTGCCAGCTCTGGGTTGACCGTGGAGGTAGATGCCCCCAAATCTCAGGACCTCGCCAAGATCATGGCAGACATCCGGGCCCAATATGACGAGCTGGCTCGGAAGAACCGAGAGGAGCTAGACAAGTACTGGTCTCAGCAGATTGAGGAGAGCACCACAGTGGTCACCACACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGAGACCAATGACACCAAAGTTCTGAGGCATTAAGCCAGCAGAAGCAGGGTACCCTTTGGGGAGCAGGAGGCCAATAAAAAGTTCAGAGTTCATTGGATG