Transcript asmbl_35549

Sequence
Transcript Sequence for observation asmbl_35549 of TGE0000166:
TTGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGAGTTCTTACAACATGGCAGACATTGACAACAAAGAACAGTCTGAACTTGATCAAGATTTGGATGATGTTGAAGAAGTAGAAGAAGAGGAAACTGGTGAAGAAACAAAACTCAAAGCACGTCAGCTAACTGTTCAGATGATGCAAAATCCTCAGATTCTTGCAGCCCTTCAAGAAAGACTTGATGGTCTGGTAGAAACACCAACAGGATACATTGAAAGCCTGCCTAGGGTAGTTAAAAGACGAGTGAATGCTCTCAAAAACCTGCAAGTTAAATGTGCACAGATAGAAGCCAAATTCTATGAGGAAGTTCACGATCTTGAAAGGAAGTATGCTGTTCTCTATCAGCCTCTATTTGATAAGCGATTTGAAATTATTAATGCAATTTATGAACCTACGGAAGAAGAATGTGAATGGAAACCAGATGAAGAAGATGAGATTTCGGAGGAATTGAAAGAAAAGGCCAAGATTGAAGATGAGAAAAAAGATGAAGAAAAAGAAGACCCCAAAGGAATTCCTGAATTTTGGTTAACTGTTTTTAAGAATGTTGACTTGCTCAGTGATATGGTTCAGGAACACGATGAACCTATTCTGAAGCACTTGAAAGATATTAAAGTGAAGTTCTCAGATGCTGGCCAGCCTATGAGTTTTGTCTTAGAATTTCACTTTGAACCCAATGAATATTTTACAAATGAAGTGCTGACAAAGACATACAGGATGAGGTCAGAACCAGATGATTCTGATCCCTTTTCTTTTGATGGACCAGAAATTATGGGTTGTACAGGGTGCCAGATAGATTGGAAAAAAGGAAAGAATGTCACTTTGAAAACTATTAAGAAGAAGCAGAAACACAAGGGACGTGGGACAGTTCGTACTGTGACTAAAACAGTTTCCAATGACTCTTTCTTTAACTTTTTTGCCCCTCCTGAAGTTCCTGAGAGTGGAGATCTGGATGATGATGCTGAAGCTATCCTTGCTGCAGACTTCGAAATTGGTCACTTTTTACGTGAGCGTATAATCCCAAGATCAGTGTTATATTTTACTGGAGAAGCTATTGAAGATGATGATGATGATTATGATGAAGAAGGTGAAGAAGCGGATGAGGTAATGTTTACCAAATGAGCAAATAATTCTCTGTGGTTAACACATTGAGAAGCAAATTGAATGACTTATGTATTCCTTTGCTATAATCATTCTGTGATTTGGGATAAAAACATTTTGGAAAACATGATTTTAGAATTCTACAGCCAAACAATGTATGTATAAGGTTTCAATAAATAAATTGCAAAACTCAGCAACATTTTTTTATTTCAAATAATTTTGTTCTGCTGCAGGGTTATCAGCTCTTTGAAGAAGTCAAAAGCTGCAGTAAACTTTTCCAACGTTGGCTGCAGTAACTATTTTCAATAAAAGCTGTCTGGATGTCTCAAGTTGTGTTGGGAAATTTTTCATATTAGAAGCTTTCAAATTAAATTGTATTATCATCAAAGTCTGTAATCATGAAAATCTGTTGATCCGTAGAGTAACTTGTATTAAATTTTCCCTACATTATGAGCCAGTTTACCTACTATGTACATACTTCATGGATGCATTTTGAACTTTAATATAGGAAGGGGAAGAAGAAGGAGATGAGGAAAATGATCCAGACTATGACCCAAAGGTGAGCAAAATTAGTGCTGCTTTCTATTAAATTTAAGATAGCTAAAGTAAGAGTTGGTGTTTTTGAATATCAAGTTTCTCTCCGTTAAAGTCTTTAATAAATAAAGCCTATTGACTGGATAACTTTGTTTTTTCAGTCCCACTGGCATTGTGAACAGTACACATAATTTCAGTGGACGTTTTTCTAAAAAACATTGTTTTTTGTTTGGACTTCGTGCTTTTTATAGTTTCAGGTACAGTGAACCCTAGGATTCTATTTTAATGGGACGATTTGTAACAGTTTTTAAGCATTAGAAAATAAAGGTTTTTAAAAGATCTGGTTGTAGGAGTGTTCGGGAACTGGGGAGCAGTGCAGTTTGTTAGATCCTTCCAACTACTCTTACTCAGTCCCTGAGAGTCCTAGTCTATTATTCCTGAGAATTTGTTATATTAGGATTAGCAAAAACAAAGCTGATTGGTAATATAACTAACATAAATTGCTTGGTAACTTTATTTTTTTAAGATTATGGTTTAGCGTGTGTCACATTTTATGGAGTTAATTCTACAGTGTAAAGTTTGAGCTTGATTTTAGCATTTCAGTGACTTGCTAATAAAATAAATAATTTACCACCATTGTCCTATACCATTTCTTTTGACAACAGTGAGCTACTGTTATAATTAAGGCAGTAATTACTATTGAGAAATTCACTGAAGCAGGTAGAAGAAGATAGATTGACTTGTTGTTTTCCTTTAACAGAAGGATCAAAACCCAGCAGAG