Transcript asmbl_29369

Sequence
Transcript Sequence for observation asmbl_29369 of TGE0057004:
GCTAGGGGTGCGGGGTTGGGGAGGAGGCCGCTAGTCTACGCCTGTGGAGCCGATACTCAGCCCTCTGCGACCATGGCTGTGCTGGCGGCACTTCTGCGCAGCGGCGCCCGCAGCCGCAGCCCCCTGCTCCGGAGGCTGGTGCAGGAAATAAGATATGTGGAACGGAGTTATGTATCAAAACCCACTTTGAAGGAAGTGGTCATAGTAAGTGCTACAAGAACACCCATTGGATCTTTTTTAGGCAGCCTTTCCTTGCTGCCAGCCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAAGCTCCTACAAGGCAGGCAGTATTGGGTGCAGGCTTACCTATTTCTACTCCATGTACCACCATAAACAAAGTTTGTGCTTCAGGAATGAAAGCCATCATGATGGCCTCTCAAAGTCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAATGTTCCATATGTAATGAACAGAGGATCAACACCATATGGTGGGGTAAAGCTTGAAGATTTGATTGTAAAAGACGGGCTAACTGATGTCTACAATAAAATTCATATGGGCAGCTGTGCTGAGAATACAGCAAAGAAGCTGAATATTGCACGAAATGAACAGGACGCTTATGCTATTAATTCTTATACCAGAAGTAAAGCAGCATGGGAAGCTGGGAAATTTGGAAATGAAGTTATTCCTGTCACAGTTACAGTAAAAGGTCAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTTAGCAAAGTTCCAAAGCTGAAGACAGTTTTCCAGAAAGAAAATGGCACAGTAACAGCTGCCAATGCCAGTACACTGAATGATGGAGCAGCTGCTCTGGTTCTCATGACGGCAGATGCAGCGAAGAGGCTCAATGTTACACCACTGGCAAGAATAGTAGCATTTGCTGACGCTGCTGTAGAACCTATTGATTTTCCAATTGCTCCTGTATATGCTGCATCTATGGTTCTTAAAGATGTGGGATTGAAAAAAGAAGATATTGCAATGTGGGAAGTAAATGAAGCCTTTAGTCTGGTTGTACTAGCAAACATTAAAATGTTGGAGATTGATCCCCAAAAAGTGAATATCAATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTTGGTCATTTGACTCATGCCTTGAAGCAAGGAGAATACGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCAGAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAGCTTATATTCAGATAAGCTGTTTCATTTTTTATTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAACATTTTGAAATTAAAAATAAATTTCTTCTTCTGCTTTTTTCTTGGTAACCTTGAA