Transcript asmbl_16389

Sequence
Transcript Sequence for observation asmbl_16389 of TGE0003333:
CGGCTCTTCCCGGGGTCCTTCCGTGCGCGTTGATATGATTGGCCGGCGAATCGTGGTTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGGAAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGATTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAAAAGACCTCAAGAAAGCAACGAAAGGAACGCAAGAACAGAATGAAGAAAGTCAGGGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGATCACAGGTATAATTCAAGCTTTTCATGTAGTCATGTAGATCACTAGACTCCTTGGTGTACTGACGTAGCAATTTAAAAGCAGATCATGTGTAGTACATCTAGAAGTAGATTTACAAATATTCTGAAGAGTTGTAACCTTTTAAAATACTAACAGTGACATGGTTTTGTTTTTAAGGTTTAGCAATATTTAGCCCATTATTTTTGTTTTATTCTTAACTTGAATGTTTGTAAATTTTATTTCTTGATGCTTTCATTGTGTTATGATAACATCAAAATAACTTGATATTCTAGGTTACTAATAATTGTTGTGCATGAGTGTTACTACTTTTGGAATTGAAGACTTTAAAGAATTTTAAAGGCAGTTGTTGACTAAACTTCTTTCTCTTGATTCACAGCCGAAGGAGTAAAGGTGCTGCAATGATGTTAGCTGTGGCCACTGTGGATTTTTCGCAAGAACATTAATAAACTAAAAACTTCATGTGTCTGGTTGTTTGAAATGTATTTGCAGTTTCCTGGGACTGCTAGG