Transcript asmbl_16388

Sequence
Transcript Sequence for observation asmbl_16388 of TGE0003333:
CGGCTCTTCCCGGGGTCCTTCCGTGCGCGTTGATATGATTGGCCGGCGAATCGTGGTTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGGAAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGATTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAAAAGACCTCAAGAAAGCAACGAAAGGAACGCAAGAACAGAATGAAGAAAGTCAGGGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGATCACAGCCGAAGGAGTAAAGGTGCTGCAATGATGTTAGCTGTGGCCACTGTGGATTTTTCGCAAGAACATTAATAAACTAAAAACTTCATGTGTCTGGTTGTTTGAAATGTATTTGCAGTTTCCTGGGACTGCTAGG