Transcript asmbl_15408

Sequence
Transcript Sequence for observation asmbl_15408 of TGE0056751:
ATTAGAGAGTTTTGTGCTGAGGTCCCTATATGGTTGTGTTAGACTGAACGACAGGCTCAAGTCTGTCTTTGCTCCTTGTTTGGGAAGCAAGTGGGAGGAGAGCAGGCCAAGGGGCTATATAACCCTTCAGCTTTCAGCTTCCCTGAACACCACCCAGTGTGGAGCAGCCCAGCCAAGCACTGTCAGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG