Transcript asmbl_15407

Sequence
Transcript Sequence for observation asmbl_15407 of TGE0056751:
CCCACCCGCGCCGGAGCGGACCTTTGGCTTGGCTTGTCAGGGCTTGTCCAGGAGTTCCGCTCCTCTCTCCAACCGGGGTCCCCCTCCAGCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCCTGTCCGCACCCCACGCCCACCTCAACGTGGAGCGCAGTGGTCTCCGAGGAGCGCCGGAGCTGCCCCGCCTGCCCAGCGGGGTCAGCACTTCGCATCAAGGCCCAAGAAAAGCAAGTCCTCCAGCGTTCTGAGCACCCGGGCCTGAGGGAAGGTCCTAACAGCCCCCGGGAGCCAGTCTCCAACGCCTCCCGCAGCAGCCCGCCGCTCCCAGGTGCCCGCGTGCGCCGCTGCCGCCGCAATCCCGCACGCGTCCCGCGCCCGCCCCACTTTGCCTATCCCCGGGACTAAGACGGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG