Transcript asmbl_141502

Sequence
Transcript Sequence for observation asmbl_141502 of TGE0056456:
GCGGGAGCGCGCGTAGCCGCTTATAAAAGAGGCGGGGCGCGCGCGTCGCCGCCACTACCCGCTGCGGAGTGAACGGTGTGGAGCGGAGGCCGCGGAGGCTCCTCGGTCCTTCAGCACCCCTCGGCCCGACGCACCCACGCCCCTCACCCCCCGAGAGCCGAAAATGGACCCAAGTGGGGTCAAAGTGCTGGAAACAGCAGAGGACATCCAGGAGAGGCGGCAGCAGGTCCTAGACCGATACCACCGCTTCAAGGAACTCTCAACCCTTAGGCGTCAGAAGCTGGAAGATTCCTATCGATTCCAGTTCTTTCAAAGAGATGCTGAAGAGCTGGAGAAATGGATACAGGAAAAACTTCAGATTGCATCTGATGAGAATTATAAAGACCCAACCAACTTGCAGGGAAAGCTTCAGAAGCATCAAGCATTTGAAGCTGAAGTGCAGGCCAACTCAGGAGCCATTGTTAAGCTGGATGAAACTGGAAACCTGATGATCTCAGAAGGGCATTTTGCATCTGAAACCATACGGACCCGTTTGATGGAGCTGCACCGCCAGTGGGAATTACTTTTGGAGAAGATGCGAGAAAAAGGAATCAAACTGCTGCAGGCCCAGAAGTTGGTGCAGTACTTACGAGAATGTGAGGACGTGATGGACTGGATCAATGACAAGGAAGCAATTGTTACTTCTGAAGAGCTGGGCCAGGATCTGGAGCATGTAGAGGTTTTACAGAAGAAATTTGAAGAGTTTCAAACAGATATGGCTGCTCATGAAGAAAGAGTTAATGAAGTGAACCAGTTTGCTGCCAAACTCATACAGGAGCAGCACCCTGAGGAGGAACTGATCAAGACTAAGCAGGATGAAGTCAATGCAGCCTGGCAGCGGCTGAAGGGCCTGGCTCTGCAGAGGCAGGGGAAGCTCTTTGGGGCAGCAGAAGTTCAGCGCTTTAACAGGGATGTGGATGAGACTATCAGTTGGATTAAGGAAAAGGAGCAGTTAATGGCCTCTGATGATTTTGGCCGAGACCTGGCAAGTGTTCAGGCTCTGCTTCGGAAGCACGAGGGTCTGGAGAGAGATCTTGCTGCTCTAGAAGACAAGGTCAAAGCCCTGTGTGCTGAGGCTGACCGCCTGCAACAGTCCCACCCTCTGAGTGCAACACAGATTCAAGTGAAGCGAGAGGAACTGATTACAAACTGGGAGCAGATCCGCACCTTGGCGGCAGAGAGACATGCACGGCTCAATGATTCATACAGGCTTCAACGCTTCCTTGCTGACTTCCGTGACCTCACCAGCTGGGTGACTGAGATGAAAGCCCTCATCAATGCAGATGAGCTTGCCAGTGATGTGGCTGGGGCTGAAGCCCTGCTAGATAGACACCAAGAGCACAAGGGTGAAATTGATGCCCATGAAGACAGCTTCAAATCTGCAGATGAATCTGGACAGGCACTGCTTGCTGCTGGTCACTATGCCTCAGATGAAGTGAGGGAGAAGCTGACCGTCCTTTCCGAGGAGAGAGCGGCGCTGCTGGAGCTGTGGGAGCTGCGCAGGCAGCAGTACGAGCAGTGCATGGACCTGCAGCTCTTCTACCGGGACACTGAGCAGGTGGACAACTGGATGAGCAAGCAGGAGGCGTTCCTGTTGAATGAAGACTTGGGAGATTCCTTGGATAGTGTGGAAGCGCTTCTTAAGAAGCACGAAGACTTTGAGAAATCCCTTAGTGCCCAGGAGGAAAAGATTACAGCATTAGATGAATTTGCAACCAAGCTAATTCAGAACAACCACTATGCAATGGAAGATGTGGCCACTCGCCGAGATGCTCTGTTGAGCCGCCGCAATGCCCTTCACGAGAGAGCCATGCGTCGCCGGGCCCAGCTAGCCGATTCTTTCCATCTGCAGCAGTTTTTCCGTGATTCTGATGAGCTCAAGAGTTGGGTCAATGAGAAGATGAAAACTGCCACAGATGAAGCTTATAAAGATCCATCCAACCTACAAGGAAAAGTACAGAAGCATCAGGCTTTTGAGGCTGAGCTCTCAGCAAACCAGAGCCGAATTGATGCCTTGGAGAAAGCTGGCCAAAAGCTGATTGATGTCAACCACTATGCCAAGGATGAAGTGGCAGCTCGTATGAATGAGGTGATCAGTTTGTGGAAGAAACTGCTAGAGGCCACTGAACTGAAAGGAATAAAGCTTCGTGAAGCCAACCAGCAACAGCAATTTAATCGCAATGTTGAGGATATTGAATTGTGGCTATATGAAGTAGAAGGTCACTTGGCTTCGGATGATTACGGCAAAGATCTTACCAATGTGCAGAACCTCCAGAAGAAACATGCACTGCTAGAGGCAGATGTGGCTGCTCACCAGGACCGAATTGATGGCATCACCATTCAGGCCCGCCAGTTCCAAGATGCTGGCCATTTTGATGCAGAAAACATCAAGAAGAAACAGGAAGCCCTCGTGGCTCGCTATGAGGCACTCAAGGAGCCCATGGTTGCCCGGAAGCAGAAGCTGGCCGATTCTCTGCGGTTGCAGCAGCTCTTCCGGGATGTTGAGGATGAGGAGACGTGGATTCGAGAGAAAGAGCCCATTGCCGCATCTACCAACAGAGGTAAGGATTTAATTGGGGTCCAGAATCTGCTAAAGAAACATCAAGCCTTACAAGCAGAAATTGCTGGACATGAACCACGCATCAAAGCAGTTACACAGAAGGGGAATGCCATGGTGGAGGAAGGCCATTTTGCTGCAGAGGATGTGAAGGCCAAGCTTCACGAGCTGAACCAAAAGTGGGAGGCACTGAAAGCCAAAGCTTCCCAGCGTCGGCAGGACCTGGAGGACTCTCTGCAGGCCCAGCAGTACTTTGCTGATGCTAACGAGGCTGAATCCTGGATGCGGGAGAAGGAACCCATTGTGGGCAGCACTGACTATGGCAAGGACGAAGACTCTGCTGAGGCTCTACTGAAGAAACACGAAGCTTTGATGTCAGATCTCAGTGCCTACGGCAGCAGCATCCAGGCTTTGCGAGAACAAGCACAGTCCTGCCGGCAACAAGTGGCCCCCACGGATGATGAGACTGGGAAGGAGCTGGTCTTGGCTCTCTACGACTATCAGGAGAAGAGTCCCCGAGAGGTCACCATGAAGAAGGGAGATATCCTTACCTTACTCAACAGCACCAACAAGGATTGGTGGAAAGTGGAAGTGAACGATCGTCAGGGTTTTGTGCCGGCTGCGTACGTGAAGAAATTGGACCCCGCCCAGTCAGCCTCCCGGGAGAATCTCCTGGAGGAGCAAGGCAGCATAGCACTGCGGCAGGAGCAGATTGACAATCAGACACGCATAACTAAGGAGGCCGGCAGTGTATCTCTGCGTATGAAGCAGGTGGAAGAACTATATCATTCTCTGCTGGAACTGGGTGAGAAGCGTAAAGGCATGTTGGAGAAGAGTTGCAAGAAGTTTATGTTGTTCCGTGAAGCGAATGAACTACAGCAATGGATCAATGAGAAGGAAGCCGCTCTGACAAGTGAGGAGGTCGGAGCAGACTTGGAGCAGGTTGAGGTGCTCCAGAAGAAGTTTGATGACTTCCAGAAGGACCTGAAGGCCAATGAGTCACGGTTGAAGGACATTAACAAGGTAGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCTGTGCAACAACAGGAAGTGTATGGCATGATGCCCAGGGATGAAACTGATTCCAAGACAGCCTCCCCGTGGAAGTCTGCTCGTCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGCTGGCGGTCCCTACAGCAGCTGGCCGAGGAACGGAGCCAGCTCTTGGGCAGCGCCCATGAAGTACAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAATGGATTGAAGAGAAGAATCAAGCTCTAAACACAGACAATTATGGACATGATCTCGCCAGTGTCCAGGCCCTGCAACGCAAGCATGAGGGCTTCGAGAGGGACCTTGCGGCTCTCGGTGACAAGGTAAACTCCCTTGGTGAAACAGCAGAGCGCCTGATCCAGTCCCATCCCGAGTCAGCAGAAGACCTGCAGGAAAAGTGCACAGAGTTAAACCAGGCCTGGAGCAGCCTGGGGAAACGTGCAGATCAGCGCAAGGCAAAGTTGGGTGACTCCCACGACCTGCAGCGCTTCCTTAGCGATTTCCGGGACCTCATGTCTTGGATCAATGGAATACGGGGGTTGGTGTCCTCAGATGAGCTAGCCAAGGATGTCACCGGAGCTGAGGCATTGCTGGAGCGACACCAGGAACACCGGACAGAAATCGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGACAGCAGCTGTTGGCTCACGGACACTATGCCAGCCCTGAGATCAAGCAGAAACTTGATATTCTTGACCAGGAGCGTGCAGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTCCATCGGGACTGTGAGCAAGCTGAGAACTGGATGGCTGCCCGGGAGGCCTTCTTGAATACCGAAGACAAAGGAGACTCACTGGACAGCGTAGAGGCTCTGATCAAAAAACATGAAGACTTTGACAAAGCGATTAACGTCCAGGAAGAGAAGATTGCTGCTCTGCAGGCCTTTGCCGACCAGCTCATCGCTGCCGGCCATTATGCCAAGGGAGACATTTCTAGCCGGCGCAATGAGGTCTTGGACAGGTGGCGACGTCTGAAAGCCCAGATGATTGAGAAAAGGTCAAAGCTAGGAGAATCTCAAACCCTCCAACAGTTCAGCCGGGATGTGGATGAGATTGAGGCTTGGATCAGTGAAAAATTGCAAACAGCGAGTGATGAGTCGTACAAGGATCCCACCAACATCCAGCTTTCCAAGCTGCTGAGCAAGCACCAGAAGCACCAGGCTTTTGAAGCAGAGCTGCATGCCAACGCTGACCGGATCCGTGGGGTTATCGACATGGGCAACTCCCTCATTGAACGTGGAGCCTGTGCCGGCAGTGAGGATGCTGTCAAGGCCCGCCTGGCTGCCTTAGCTGACCAGTGGCAGTTCTTGGTGCAAAAGTCAGCGGAAAAGAGCCAGAAACTGAAAGAAGCCAACAAGCAGCAGAACTTCAACACAGGGATCAAGGACTTTGACTTCTGGCTGTCTGAGGTGGAGGCCCTGCTGGCATCCGAAGATTATGGCAAAGACCTAGCTTCTGTGAACAACCTGCTGAAAAAGCATCAACTGCTGGAAGCAGATATATCTGCCCATGAGGATCGCCTGAAGGACCTGAACAGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCAAGTAAAGGACAAGAGGGACACCATCAACGGGCGCTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGGGCTCAGAGGACTACGGCCGGGACCTAACCGGCGTGCAGAACCTGAGGAAGAAGCACAAGCGGCTGGAAGCAGAACTGGCTGCGCATGAGCCGGCTATTCAGGGTGTCCTGGACACTGGCAAGAAGCTGTCCGATGACAACACCATCGGGAAAGAGGAGATCCAGCAGCGGCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCAGCTGCCCGGGGTCAGCGGCTGGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAATGTGGAAGAGGAAGAAGCCTGGATCAATGAGAAAATGACCCTGGTGGCCAGCGAAGATTATGGCGACACTCTTGCCGCCATCCAGGGCTTACTGAAGAAACATGAAGCTTTTGAGACAGACTTCACCGTCCACAAGGATCGCGTGAATGATGTCTGCACCAATGGACAAGACCTCATTAAGAAGAACAATCACCATGAGGAGAACATCTCTTCAAAGATGAAGGGCCTGAACGGGAAAGTGTCAGACCTGGAGAAAGCTGCAGCCCAGAGAAAGGCGAAGCTGGATGAGAACTCGGCCTTCCTTCAGTTCAACTGGAAGGCGGACGTGGTGGAGTCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGATTATGGCCGAGACCTGTCTTCTGTGCAGACGCTCCTCACCAAACAGGAAACTTTTGACGCTGGGCTGCAGGCCTTCCAGCAGGAAGGCATTGCCAACATCACTGCCCTCAAAGATCAGCTTCTCGCCGCCAAACACGTTCAGTCCAAGGCCATCGAGGCCCGGCACGCCTCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCGCCCGCAAGAAGAAGCTTCTGGAGGCTCAGAGTCACTTCCGCAAGGTGGAGGACCTCTTCCTGACCTTCGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAATGCAGAGGAGGACTTAACAGACCCCGTGCGCTGCAACTCCTTGGAAGAAATCAAAGCTTTGCGCGAGGCCCACGACGCCTTCCGCTCCTCCCTCAGCTCTGCCCAGGCTGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTAGCCTCCAACCCCTACACCTGGTTTACCATGGAGGCCCTGGAGGAGACCTGGAGGAACCTACAGAAAATCATCAAGGAGAGGGAGCTGGAGCTGCAGAAGGAACAGCGGCGGCAGGAGGAGAACGACAAGCTGCGCCAGGAGTTTGCCCAGCACGCCAACGCCTTCCACCAGTGGATCCAAGAGACCAGGACATACCTCCTCGATGGGTCCTGTATGGTGGAAGAGTCGGGGACCCTCGAATCCCAGCTTGAAGCTACCAAACGCAAGCACCAGGAAATCCGAGCCATGAGAAGTCAGCTCAAAAAGATCGAGGACCTGGGGGCCGCCATGGAGGAGGCCCTCATCCTGGACAACAAGTACACGGAGCACAGCACCGTGGGCCTCGCCCAGCAGTGGGACCAGCTGGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACAACAGGTGTGACTGAGGAGGCCCTCAAAGAATTCAGCATGATGTTTAAACACTTTGACAAGGACAAGTCTGGCAGGCTGAACCATCAGGAGTTCAAATCTTGCCTGCGCTCCCTGGGCTATGACCTGCCCATGGTGGAGGAAGGGGAACCTGACCCTGAGTTCGAGGCAATCCTGGACACGGTGGATCCGAACAGAGATGGCCATGTCTCCTTGCAAGAATACATGGCTTTCATGATCAGCCGCGAAACTGAGAACGTCAAGTCCAGCGAGGAGATTGAGAGCGCCTTCCGGGCCCTCAGCTCAGAGGGAAAGCCTTACGTGACCAAGGAGGAGCTCTACCAGAACCTGACCCGGGAACAAGCCGACTACTGCGTCTCCCACATGAAGCCCTACGTGGACGGCAAGGGCCGCGAGCTCCCCACCGCGTTCGACTACGTGGAGTTCACCCGCTCGCTTTTCGTGAACTGAGCCACTCCCTGGGTCACCCACCCCTCGCTGCTTGCCCTGCGTCGCCTTGCTGCATGTCCGCTCCTCTGTGTGCTCTCACTTTCCACTGTAACCTTAAGCCTGCTTAGCTTGGAATAAGACTTAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGGACCCAGATCTGTGTCTTGAAGCAGCTGCCCTCATTCCGACTTCAGAAAATCGAAGCAGCTGGCTCCTCCCCTTGTTCTCTCTCCCACCCTCCCCCAAATCTGTTTTCATGTAAAAGACAAATAAATGATGACTTCCCCC