Transcript asmbl_140734

Sequence
Transcript Sequence for observation asmbl_140734 of TGE0056456:
GCGGGAGCGCGCGTAGCCGCTTATAAAAGAGGCGGGGCGCGCGCGTCGCCGCCACTACCCGCTGCGGAGTGAACGGTGTGGAGCGGAGGCCGCGGAGGCTCCTCGGTCCTTCAGCACCCCTCGGCCCGACGCACCCACGCCCCTCACCCCCCGAGAGCCGAAAATGGACCCAAGTGGGGTCAAAGTGCTGGAAACAGCAGAGGACATCCAGGAGAGGCGGCAGCAGGTCCTAGACCGATACCACCGCTTCAAGGAACTCTCAACCCTTAGGCGTCAGAAGCTGGAAGATTCCTATCGATTCCAGTTCTTTCAAAGAGATGCTGAAGAGCTGGAGAAATGGATACAGGAAAAACTTCAGATTGCATCTGATGAGAATTATAAAGACCCAACCAACTTGCAGGGAAAGCTTCAGAAGCATCAAGCATTTGAAGCTGAAGTGCAGGCCAACTCAGGAGCCATTGTTAAGCTGGATGAAACTGGAAACCTGATGATCTCAGAAGGGCATTTTGCATCTGAAACCATACGGACCCGTTTGATGGAGCTGCACCGCCAGTGGGAATTACTTTTGGAGAAGATGCGAGAAAAAGGAATCAAACTGCTGCAGGCCCAGAAGTTGGTGCAGTACTTACGAGAATGTGAGGACGTGATGGACTGGATCAATGACAAGGAAGCAATTGTTACTTCTGAAGAGCTGGGCCAGGATCTGGAGCATGTAGAGGTTTTACAGAAGAAATTTGAAGAGTTTCAAACAGATATGGCTGCTCATGAAGAAAGAGTTAATGAAGTGAACCAGTTTGCTGCCAAACTCATACAGGAGCAGCACCCTGAGGAGGAACTGATCAAGACTAAGCAGGATGAAGTCAATGCAGCCTGGCAGCGGCTGAAGGGCCTGGCTCTGCAGAGGCAGGGGAAGCTCTTTGGGGCAGCAGAAGTTCAGCGCTTTAACAGGGATGTGGATGAGACTATCAGTTGGATTAAGGAAAAGGAGCAGTTAATGGCCTCTGATGATTTTGGCCGAGACCTGGCAAGTGTTCAGGCTCTGCTTCGGAAGCACGAGGGTCTGGAGAGAGATCTTGCTGCTCTAGAAGACAAGGTCAAAGCCCTGTGTGCTGAGGCTGACCGCCTGCAACAGTCCCACCCTCTGAGTGCAACACAGATTCAAGTGAAGCGAGAGGAACTGATTACAAACTGGGAGCAGATCCGCACCTTGGCGGCAGAGAGACATGCACGGCTCAATGATTCATACAGGCTTCAACGCTTCCTTGCTGACTTCCGTGACCTCACCAGCTGGGTGACTGAGATGAAAGCCCTCATCAATGCAGATGAGCTTGCCAGTGATGTGGCTGGGGCTGAAGCCCTGCTAGATAGACACCAAGAGCACAAGGGTGAAATTGATGCCCATGAAGACAGCTTCAAATCTGCAGATGAATCTGGACAGGCACTGCTTGCTGCTGGTCACTATGCCTCAGATGAAGTGAGGGAGAAGCTGACCGTCCTTTCCGAGGAGAGAGCGGCGCTGCTGGAGCTGTGGGAGCTGCGCAGGCAGCAGTACGAGCAGTGCATGGACCTGCAGCTCTTCTACCGGGACACTGAGCAGGTGGACAACTGGATGAGCAAGCAGGAGGCGTTCCTGTTGAATGAAGACTTGGGAGATTCCTTGGATAGTGTGGAAGCGCTTCTTAAGAAGCACGAAGACTTTGAGAAATCCCTTAGTGCCCAGGAGGAAAAGATTACAGCATTAGATGAATTTGCAACCAAGCTAATTCAGAACAACCACTATGCAATGGAAGATGTGGCCACTCGCCGAGATGCTCTGTTGAGCCGCCGCAATGCCCTTCACGAGAGAGCCATGCGTCGCCGGGCCCAGCTAGCCGATTCTTTCCATCTGCAGCAGTTTTTCCGTGATTCTGATGAGCTCAAGAGTTGGGTCAATGAGAAGATGAAAACTGCCACAGATGAAGCTTATAAAGATCCATCCAACCTACAAGGAAAAGTACAGAAGCATCAGGCTTTTGAGGCTGAGCTCTCAGCAAACCAGAGCCGAATTGATGCCTTGGAGAAAGCTGGCCAAAAGCTGATTGATGTCAACCACTATGCCAAGGATGAAGTGGCAGCTCGTATGAATGAGGTGATCAGTTTGTGGAAGAAACTGCTAGAGGCCACTGAACTGAAAGGAATAAAGCTTCGTGAAGCCAACCAGCAACAGCAATTTAATCGCAATGTTGAGGATATTGAATTGTGGCTATATGAAGTAGAAGGTCACTTGGCTTCGGATGATTACGGCAAAGATCTTACCAATGTGCAGAACCTCCAGAAGAAACATGCACTGCTAGAGGCAGATGTGGCTGCTCACCAGGACCGAATTGATGGCATCACCATTCAGGCCCGCCAGTTCCAAGATGCTGGCCATTTTGATGCAGAAAACATCAAGAAGAAACAGGAAGCCCTCGTGGCTCGCTATGAGGCACTCAAGGAGCCCATGGTTGCCCGGAAGCAGAAGCTGGCCGATTCTCTGCGGTTGCAGCAGCTCTTCCGGGATGTTGAGGATGAGGAGACGTGGATTCGAGAGAAAGAGCCCATTGCCGCATCTACCAACAGAGGTAAGGATTTAATTGGGGTCCAGAATCTGCTAAAGAAACATCAAGCCTTACAAGCAGAAATTGCTGGACATGAACCACGCATCAAAGCAGTTACACAGAAGGGGAATGCCATGGTGGAGGAAGGCCATTTTGCTGCAGAGGATGTGAAGGCCAAGCTTCACGAGCTGAACCAAAAGTGGGAGGCACTGAAAGCCAAAGCTTCCCAGCGTCGGCAGGACCTGGAGGACTCTCTGCAGGCCCAGCAGTACTTTGCTGATGCTAACGAGGCTGAATCCTGGATGCGGGAGAAGGAACCCATTGTGGGCAGCACTGACTATGGCAAGGACGAAGACTCTGCTGAGGCTCTACTGAAGAAACACGAAGCTTTGATGTCAGATCTCAGTGCCTACGGCAGCAGCATCCAGGCTTTGCGAGAACAAGCACAGTCCTGCCGGCAACAAGTGGCCCCCACGGATGATGAGACTGGGAAGGAGCTGGTCTTGGCTCTCTACGACTATCAGGAGAAGAGTCCCCGAGAGGTCACCATGAAGAAGGGAGATATCCTTACCTTACTCAACAGCACCAACAAGGATTGGTGGAAAGTGGAAGTGAACGATCGTCAGGGTTTTGTGCCGGCTGCGTACGTGAAGAAATTGGACCCCGCCCAGTCAGCCTCCCGGGAGAATCTCCTGGAGGAGCAAGGCAGCATAGCACTGCGGCAGGAGCAGATTGACAATCAGACACGCATAACTAAGGAGGCCGGCAGTGTATCTCTGCGTATGAAGCAGGTGGAAGAACTATATCATTCTCTGCTGGAACTGGGTGAGAAGCGTAAAGGCATGTTGGAGAAGAGTTGCAAGAAGTTTATGTTGTTCCGTGAAGCGAATGAACTACAGCAATGGATCAATGAGAAGGAAGCCGCTCTGACAAGTGAGGAGGTCGGAGCAGACTTGGAGCAGGTTGAGGTGCTCCAGAAGAAGTTTGATGACTTCCAGAAGGACCTGAAGGCCAATGAGTCACGGTTGAAGGACATTAACAAGGTAGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCTGTGCAACAACAGGAAGTGTATGGCATGATGCCCAGGGATGAAACTGATTCCAAGACAGCCTCCCCGTGGAAGTCTGCTCGTCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGCTGGCGGTCCCTACAGCAGCTGGCCGAGGAACGGAGCCAGCTCTTGGGCAGCGCCCATGAAGTACAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAATGGATTGAAGAGAAGAATCAAGCTCTAAACACAGACAATTATGGACATGATCTCGCCAGTGTCCAGGCCCTGCAACGCAAGCATGAGGGCTTCGAGAGGGACCTTGCGGCTCTCGGTGACAAGGTAAACTCCCTTGGTGAAACAGCAGAGCGCCTGATCCAGTCCCATCCCGAGTCAGCAGAAGACCTGCAGGAAAAGTGCACAGAGTTAAACCAGGCCTGGAGCAGCCTGGGGAAACGTGCAGATCAGCGCAAGGCAAAGTTGGGTGACTCCCACGACCTGCAGCGCTTCCTTAGCGATTTCCGGGACCTCATGTCTTGGATCAATGGAATACGGGGGTTGGTGTCCTCAGATGAGCTAGCCAAGGATGTCACCGGAGCTGAGGCATTGCTGGAGCGACACCAGGAACACCGGACAGAAATCGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGACAGCAGCTGTTGGCTCACGGACACTATGCCAGCCCTGAGATCAAGCAGAAACTTGATATTCTTGACCAGGAGCGTGCAGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTCCATCGGGACTGTGAGCAAGCTGAGAACTGGATGGCTGCCCGGGAGGCCTTCTTGAATACCGAAGACAAAGGAGACTCACTGGACAGCGTAGAGGCTCTGATCAAAAAACATGAAGACTTTGACAAAGCGATTAACGTCCAGGAAGAGAAGATTGCTGCTCTGCAGGCCTTTGCCGACCAGCTCATCGCTGCCGGCCATTATGCCAAGGGAGACATTTCTAGCCGGCGCAATGAGGTCTTGGACAGGTGGCGACGTCTGAAAGCCCAGATGATTGAGAAAAGGTCAAAGCTAGGAGAATCTCAAACCCTCCAACAGTTCAGCCGGGATGTGGATGAGATTGAGGCTTGGATCAGTGAAAAATTGCAAACAGCGAGTGATGAGTCGTACAAGGATCCCACCAACATCCAGCTTTCCAAGCTGCTGAGCAAGCACCAGAAGCACCAGGCTTTTGAAGCAGAGCTGCATGCCAACGCTGACCGGATCCGTGGGGTTATCGACATGGGCAACTCCCTCATTGAACGTGGAGCCTGTGCCGGCAGTGAGGATGCTGTCAAGGCCCGCCTGGCTGCCTTAGCTGACCAGTGGCAGTTCTTGGTGCAAAAGTCAGCGGAAAAGAGCCAGAAACTGAAAGAAGCCAACAAGCAGCAGAACTTCAACACAGGGATCAAGGACTTTGACTTCTGGCTGTCTGAGGTGGAGGCCCTGCTGGCATCCGAAGATTATGGCAAAGACCTAGCTTCTGTGAACAACCTGCTGAAAAAGCATCAACTGCTGGAAGCAGATATATCTGCCCATGAGGATCGCCTGAAGGACCTGAACAGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCAAGTAAAGGACAAGAGGGACACCATCAACGGGCGCTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGGGCTCAGAGGACTACGGCCGGGACCTAACCGGCGTGCAGAACCTGAGGAAGAAGCACAAGCGGCTGGAAGCAGAACTGGCTGCGCATGAGCCGGCTATTCAGGGTGTCCTGGACACTGGCAAGAAGCTGTCCGATGACAACACCATCGGGAAAGAGGAGATCCAGCAGCGGCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCAGCTGCCCGGGGTCAGCGGCTGGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAATGTGGAAGAGGAAGAAGCCTGGATCAATGAGAAAATGACCCTGGTGGCCAGCGAAGATTATGGCGACACTCTTGCCGCCATCCAGGGCTTACTGAAGAAACATGAAGCTTTTGAGACAGACTTCACCGTCCACAAGGATCGCGTGAATGATGTCTGCACCAATGGACAAGACCTCATTAAGAAGAACAATCACCATGAGGAGAACATCTCTTCAAAGATGAAGGGCCTGAACGGGAAAGTGTCAGACCTGGAGAAAGCTGCAGCCCAGAGAAAGGCGAAGCTGGATGAGAACTCGGCCTTCCTTCAGTTCAACTGGAAGGCGGACGTGGTGGAGTCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGATTATGGCCGAGACCTGTCTTCTGTGCAGACGCTCCTCACCAAACAGGAAACTTTTGACGCTGGGCTGCAGGCCTTCCAGCAGGAAGGCATTGCCAACATCACTGCCCTCAAAGATCAGCTTCTCGCCGCCAAACACGTTCAGTCCAAGGCCATCGAGGCCCGGCACGCCTCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCGCCCGCAAGAAGAAGCTTCTGGAGGCTCAGAGTCACTTCCGCAAGGTGGAGGACCTCTTCCTGACCTTCGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAATGCAGAGGAGGACTTAACAGACCCCGTGCGCTGCAACTCCTTGGAAGAAATCAAAGCTTTGCGCGAGGCCCACGACGCCTTCCGCTCCTCCCTCAGCTCTGCCCAGGCTGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTAGCCTCCAACCCCTACACCTGGTTTACCATGGAGGCCCTGGAGGAGACCTGGAGGAACCTACAGAAAATCATCAAGGAGAGGGAGCTGGAGCTGCAGAAGGAACAGCGGCGGCAGGAGGAGAACGACAAGCTGCGCCAGGAGTTTGCCCAGCACGCCAACGCCTTCCACCAGTGGATCCAAGAGACCAGGACATACCTCCTCGATGGGTCCTGTATGGTGGAAGAGTCGGGGACCCTCGAATCCCAGCTTGAAGCTACCAAACGCAAGCACCAGGAAATCCGAGCCATGAGAAGTCAGCTCAAAAAGATCGAGGACCTGGGGGCCGCCATGGAGGAGGCCCTCATCCTGGACAACAAGTACACGGAGCACAGCACCGTGGGCCTCGCCCAGCAGTGGGACCAGCTGGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACAACAGGTGTGACTGAGGAGGCCCTCAAAGAATTCAGCATGATGTTTAAACACTTTGACAAGGACAAGTCTGGCAGGCTGAACCATCAGGAGTTCAAATCTTGCCTGCGCTCCCTGGGCTATGACCTGCCCATGGTGGAGGAAGGGGAACCTGACCCTGAGTTCGAGGCAATCCTGGACACGGTGGATCCGAACAGAGATGGCCATGTCTCCTTGCAAGAATACATGGCTTTCATGATCAGCCGCGAAACTGAGAACGTCAAGTCCAGCGAGGAGATTGAGAGCGCCTTCCGGGCCCTCAGCTCAGAGGGAAAGCCTTACGTGACCAAGGAGGAGCTCTACCAGAACCTGACCCGGGAACAAGCCGACTACTGCGTCTCCCACATGAAGCCCTACGTGGACGGCAAGGGCCGCGAGCTCCCCACCGCGTTCGACTACGTGGAGTTCACCCGCTCGCTTTTCGTGAACTGAGCCACTCCCTGGGTCACCCACCCCTCGCTGCTTGCCCTGCGTCGCCTTGCTGCATGTCCGCTCCTCTGTGTGCTCTCACTTTCCACTGTAACCTTAAGCCTGCTTAGCTTGGAATAAGACTTAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGGACCCAGATCTGTGTCTTGAAGCAGCTGCCCTCATTCCGACTTCAGAAAATCGAAGCAGCTGGCTCCTCCCCTTGTTCTCTCTCCCACCCTCCCCCAAATCTGTTTTCATGTAAAAGACAAATAAATGATGACTTCCCCC