Transcript asmbl_135219

Sequence
Transcript Sequence for observation asmbl_135219 of TGE0056441:
CGGCATTCTTTGGGCGTGAGTCATGCAGGTTTGCAGCCAGCCCCAAAGGGGGTGTGTGCGCGAGCAGAGCGCTATAAATACGGCGCCTCCCAGTGCCCACAACGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGACTCCAGAATTGGAGGCATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGAGATGTGGATGTTGCTTTTGCACCTACGGGGGCATCTGAGTCCAGCTCCCCCCAAGATGAGCTGCAGCCCCCCAGAGAGAGCTCTGCACGTCACCAAGTAACCAGGCCCCAGCCTCCAGGCCCCCAACTCCGCCCAGCCTCTCCCCGCTCTGGATCCTGCACTCTAACACTCGACTCTGCTGCTCATGGGAAGAACAGAATTGCTCCTGCATGCAACTAATTCAATAAAACTGTCTTGTGAGCTGATCGCTTGGAGGGTCCTCTTTTTATGTTGAGTTGCTGCTTCCCGGCATGCCTTCATTTTGCTATGGGGGGCAGGCAGGGGGGATGGAAAATAAGTAGAAACAAAAAAGCAGTGGCTAAGATGGTATAGGGACTGTCATACCAGTGAAGAATAAAAGGGTGAAGAATAAAAGGGATATGATGACAAGGTTGATCCACTTCAAGAATTGCTTGCTTTCAGGAAGAGAGATGTGTTTCAACAAGCCAACTAAAATATATTGCTGCAAATGGAAGCTTTTCTGTTCTATTATAAAACTGTCGATGTATTCTGACCAAGGTGCGACAATCTCCTAAAGGAATACACTGAAAGTTAAGGAGAAGAATCAGTAAGTGTAAGGTGTACTTGGTATTATAATGCATAATTGATGTTTTCGTTATGAAAACATTTGGTGCCCAGAAGTCCAAATTATCAGTTTTATTTGTAAGAGCTATTGCTTTTGCAGCGGTTTTATTTGTAAAAGCTGTTGATTTCGAGTTGTAAGAGCTCAGCATCCCAGGGGCATCTTCTTGACTGTGGCATTTCCTGTCCACCGCCGGTTTATATGATCTTCATACCTTTCCCTGGACCACAGGCGTTTCTCGGCTTTTAGTCTGAACCATAGCTGGGCTGCAGTACCCTACGCTGCCAGCAGGTGGCCATGACTACCCGTGGTACCAATCTCAG