Transcript asmbl_125515

Sequence
Transcript Sequence for observation asmbl_125515 of TGE0002448:
CTATTTGAGCGCATGCGCAAGACATGCTAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAGTTCCCTC