Transcript asmbl_119240

Sequence
Transcript Sequence for observation asmbl_119240 of TGE0002270:
CGTGGAGGCGCCGGGGCGTGCCGGCCATGTTGGGGAGTGCGGCGCCGCGGCCCGCGCCACCTCCGCCCCCCGCGGCTTGCCTCCAGCCCGCCCCTCCCGGCCCTCCTCCCCCCGCCCGCCGCTCCGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCTCGTCTTGCATTTTCCCGCGTGCGTGTGTGAGTGGGTGTGTGTGTTTTCTTACAAAGGGTATTTCGCGATCGATCGATTGATTCGTAGTTCCCCCCCGCGCGCCTTTGCCCTTTGTGCTGTAATCGAGCTCCCGCCATCCCAGGTGCTTCTCCGTTCCTCTAAACGCCAGCGTCTGGACGTGAGCGCAGGTCGCCGGTTTGTGCCTTCGGTCCCCGCTTCGCCCCCTGCCGTCCCCTCCTTATCACGGTCCCGCTCGCGGCCTCGCCGCCCCGCTGTCTCCGCCGCCCGCCATGGCGACTGCGACCCCCGTGCCGCCGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGAGCTCAATGACCGGCTGGCGGTGTACATCGACAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACGGAGCGCGAGGAGGTGCGCGGCCGTGAGCTCACCGGCCTCAAGGCGCTCTACGAGACCGAGCTGGCCGACGCGCGACGCGCGCTCGACGACACGGCCCGCGAGCGCGCCAAGCTGCAGATCGAGCTGGGCAAGTGCAAGGCGGAACACGACCAGCTGCTCCTCAACTATGCTAAGAAGGAATCTGATCTTAATGGCGCCCAGATCAAGCTTCGAGAATATGAAGCAGCACTGAATTCGAAAGATGCAGCTCTTGCTACTGCACTTGGTGACAAAAAAAGTTTAGAGGGAGATTTGGAGGATCTGAAGGATCAGATTGCCCAGTTGGAAGCCTCCTTAGCTGCAGCCAAAAAACAGTTAGCAGATGAAACTTTACTTAAAGTAGATTTGGAGAATCGTTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGCAAAAGCATGTATGAAGAGGAGATTAACGAGACCAGAAGGAAGCATGAAACGCGCTTGGTAGAGGTGGATTCTGGGCGTCAAATTGAGTATGAGTACAAGCTGGCGCAAGCCCTTCATGAGATGAGAGAGCAACATGATGCCCAAGTGAGGCTGTATAAGGAGGAGCTGGAGCAGACTTACCATGCCAAACTTGAGAATGCCAGACTGTCATCAGAGATGAATACTTCTACTGTCAACAGTGCCAGGGAAGAACTGATGGAAAGCCGCATGAGAATTGAGAGCCTTTCATCCCAGCTTTCTAATCTACAGAAAGAGTCTAGAGCATGTTTGGAAAGGATTCAAGAATTAGAGGACTTGCTTGCTAAAGAAAAAGACAACTCTCGTCGCATGCTGACAGACAAAGAGAGAGAGATGGCGGAAATAAGGGATCAAATGCAGCAACAGCTGAATGACTATGAACAGCTTCTTGATGTAAAGTTAGCCCTGGACATGGAAATCAGTGCTTACAGGAAACTCTTAGAAGGCGAAGAAGAGAGGTTGAAGCTGTCTCCAAGCCCTTCTTCCCGTGTGACAGTATCCCGAGCATCCTCAAGTCGTAGTGTACGTACAACTAGAGGAAAGCGGAAGAGGGTTGATGTGGAAGAATCAGAGGCGAGTAGTAGTGTTAGCATCTCTCATTCCGCCTCAGCCACTGGAAATGTTTGCATCGAAGAAATTGATGTTGATGGGAAATTTATCCGCTTGAAGAACACTTCTGAACAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTATAAATATACCTCAAGATATGTGCTGAAGGCAGGCCAGACTGTTACAATTTGGGCTGCAAACGCTGGTGTCACAGCCAGCCCCCCAACTGACCTCATCTGGAAGAACCAGAACTCGTGGGGCACTGGCGAAGATGTGAAGGTTATATTGAAAAATTCTCAGGGAGAGGAGGTTGCTCAAAGAAGTACAGTCTTTAAAACAACCATACCTGAAGAAGAGGAGGAGGAGGAAGAAGCAGCTGGAGTGGTTGTTGAGGAAGAACTTTTCCACCAGCAGGGAACCCCAAGAGCATCCAATAGAAGCTGTGCAATTATGTAAAATTTTCAACTGTCTTCCTCAAAATAAAGAAGTATGGTAATCTTTACCTGTATACAGTGCAGAGCCTTCTCAGAAGCACAGAATATTTTTATATTTCCTTTATGTGAATTTTTAAGCTGCAAATCTGATGGCCTTAATTTCCTTTTTGACACTGAAAGTTTTGTAAAAGAAATCATGTCCATACACTTTGTTGCAAGATGTGAATTATTGACACTGAACTTAATAACTGTGTACTGTTCGGAAGGGGTTCCTCAAATTTTTTGACTTTTTTTGTATGTGTGTTTTTTCTTTTTTTTTAAGTTCTTATGAGGAGGGGAGGGTAAATAAACCACTGTGCGTCTTGGTGTAATTTGAAGATTGCCCCATCTAGACTAGCAATCTCTTCATTATTCTCTGCTATATATAAAACGGTGCTGTGAGGGAGGGGAAAAGCATTTTTCAATATATTGAACTTTTGTACTGAATTTTTTTGTAATAAGCAATCAAGGTTATAATTTTTTTTAAAATAGAAATTTTGTAAGAAGGCAATATTAACCTAATCACCATGTAAGCACTCTGGATGATGGATTCCACAAAACTTGGTTTTATGGTTACTTCTTCTCTTAGATTCTTAATTCATGAGGAGG