Transcript asmbl_11425

Sequence
Transcript Sequence for observation asmbl_11425 of TGE0002126:
GTTGAGGTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCGCCATGATGGGCCATCGTCCAGTGCTCGTGCTCAGCCAGAACACAAAGCGTGAATCCGGAAGAAAAGTTCAATCTGGAAACATCAATGCTGCCAAGACTATTGCAGATATCATCCGAACATGTTTGGGACCCAAGTCCATGATGAAGATGCTTTTGGACCCAATGGGAGGCATTGTGATGACCAATGATGGCAATGCCATTCTTCGAGAGATTCAAGTCCAGCATCCAGCGGCCAAGTCCATGATCGAAATTAGCCGGACCCAGGATGAAGAGGTTGGAGATGGGACCACATCAGTAATTATTCTTGCAGGGGAAATGCTGTCTGTAGCTGAGCACTTCCTGGAGCAGCAGATGCACCCAACAGTGGTGATCAGTGCTTACCGCAAGGCATTGGATGATATGATCAGCACCCTAAAGAAAATAAGTATCCCAGTCGACATCAGTGACAGTGATATGATGCTGAACATCATCAACAGCTCTATTACTACCAAAGCCATCAGTCGGTGGTCATCTTTGGCTTGCAACATTGCCCTGGATGCTGTCAAGATGGTACAGTTTGAGGAGAATGGTCGGAAAGAGATTGACATAAAAAAATATGCAAGAGTGGAAAAGATACCTGGAGGCATCATTGAAGACTCCTGTGTCTTGCGTGGAGTCATGATTAACAAGGATGTGACCCATCCACGTATGCGGCGCTATATCAAGAACCCTCGCATTGTGCTGCTGGATTCTTCTCTGGAATACAAGAAAGGAGAAAGCCAGACTGACATTGAGATTACACGAGAGGAGGACTTCACCCGAATTCTCCAGATGGAGGAAGAGTACATCCAGCAGCTCTGTGAGGACATTATCCAACTGAAGCCCGATGTGGTCATCACTGAAAAGGGCATCTCAGATTTAGCTCAGCACTACCTTATGCGGGCCAATATCACAGCCATCCGCAGAGTCCGGAAGACAGACAATAATCGCATTGCTAGAGCCTGTGGGGCCCGGATAGTCAGCCGACCAGAGGAACTGAGAGAAGATGATGTTGGAACAGGAGCAGGCCTGTTGGAAATCAAGAAAATTGGAGATGAATACTTTACTTTCATCACTGACTGCAAAGACCCCAAGGCCTGCACCATTCTCCTCCGGGGGGCTAGCAAAGAGATTCTCTCGGAAGTAGAACGCAACCTCCAGGATGCCATGCAAGTGTGTCGCAATGTTCTCCTGGACCCTCAGCTGGTGCCAGGGGGTGGGGCCTCCGAGATGGCTGTGGCCCATGCCTTGACAGAAAAATCCAAGGCCATGACTGGTGTGGAACAATGGCCATACAGGGCTGTTGCCCAGGCCCTAGAGGTCATTCCTCGTACCCTGATCCAGAACTGTGGGGCCAGCACCATCCGTCTACTTACCTCCCTTCGGGCCAAGCACACCCAGGAGAACTGTGAGACCTGGGGTGTAAATGGTGAGACGGGTACTTTGGTGGACATGAAGGAACTGGGCATATGGGAGCCATTGGCTGTGAAGCTGCAGACTTATAAGACAGCAGTGGAGACGGCAGTTCTGCTACTGCGAATTGATGACATCGTTTCAGGCCACAAAAAGAAAGGCGATGACCAGAGCCGGCAAGGCGGGGCTCCTGATGCTGGCCAGGAGTGAGTGCTAGGCAAGGCTACTTCAATGCACAGAACCAGCAGAGTCTCCCCTTTTCCTGAGCCAGAGTGCCAGGAACACTGTGGACGTCTTTGTTCAGAAGGGATCAGGTTGGGGGGCAGCCCCCAGTCCCTTTCTGTCCCAGCTCAGTTTTCCAAAAGACACTGACATGTAATTCTTCTCTATTGTAAGGTTTCCATTTAGTTTGCTTCCGATGATTAAATCTAAGTCATTT