Transcript asmbl_108853

Sequence
Transcript Sequence for observation asmbl_108853 of TGE0056378:
GCCTGCGGTTGGGGCCCTGGCGGGGGTGGGACGGGCCAAGCCGGGCAGGGCCGGGGTGGGGCCGCTGGCGTTTCCGTTGCTTGGATCAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCGGCTCTCCGCCGCTCTCCCGGGGTTTCGGGGCACTTGGGTCCCACAGTCTGGTCCTGCTTCACCTTCCCCTGACCTGAGTAGTCGCCATGGCACAGGTTCTCAGAGGCACTGTGACTGACTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAGAGCATCCTGACTCTGTTGACATCCCGAAGTAATGCTCAGCGCCAGGAAATCTCTGCAGCTTTTAAGACTCTGTTTGGCAGGGATCTTCTGGATGACCTGAAATCAGAACTAACTGGAAAATTTGAAAAATTAATTGTGGCTCTGATGAAACCCTCTCGGCTTTATGATGCTTATGAACTGAAACATGCCTTGAAGGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGTATTGCGTGGAGATTAATTACAGTTTGATTAAAAAGCCTGAAGTTGGACTGGGCTGAATCTAGTTAAGTAAGGTCACTTAAAATTCTTTTAATAATTTGTGGTACTTGCTGATTCTTACTGCGATGATTCTGACTGTATGTTGCCTGTGCTTGTTTGTGTTTCAGAATATCTGGTCTAAATTCTTAACAGCTAACTCATACATGTTTTAGATAGTAGTATCTTGTTCCTTTCATAGAATGATAGCGGTATCTTGTTCTTTCATAGAATTTAAAATCAGTAGGGTCATTATTGGTTTTGGACAGTGCTGGGTGATGATAACGTGAAATAGTGCAGGATTGATCTTAATAAAAGCATATTATTCCTAGAGAAAGAGTGTTATTGAATAACCATCAGGTGGAACCATTTTTCCTTTTGAATGA