Transcript asmbl_29601

Sequence
Transcript Sequence for observation asmbl_29601 of TGE0008917:
ACGAGCCACACCGTCTTCGGGCCGATCCGTGGTGGACGTTTTCGGAGTAGGCGAGCCGCAGCCTGTGCGCCCCCTCACCGTCTCCTGTGAAACCCTGAGCCGGCTGTGTAGCTTTCTCCCTTTGTCTCAACCATGTCCACCAACGAGAATGCTAATTCACCAGCTGCCCGCCTCAACAGATTCAAGAACAAGGGGAAAGACAGTACAGAAATGAGGCGGCGCCGAATAGAAGTTAATGTGGAACTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAAAGGAGAAATGTAAGCTCGTTTCCTGATGATGCTACTTCTCCACTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAACAGCAACAATTTGGAAAACCAACTCCAAGCTACTCAAGCTGCTAGGAAACTGCTTTCTAGGGAAAAACAGCCACCCATAGACAACATAATCCGGGCTGGTTTGATTCCAAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCCCTCACTAACATTGCTTCTGGAACATCAGAACAGACCAAGGCTGTAGTTGACGGAGGTGCTATCCCAGCATTCATTTCTCTTTTGGCATCGCCCCATGCTCACATCAGTGAACAAGCCGTATGGGCTCTAGGAAACATTGCAGGTGATGGTTCAGTTTTCCGAGACTTGGTTATCAAGTATGGTGCAGTGGACCCACTGTTGGCTCTTCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGTTACTTACGTAATCTTACCTGGACGCTTTCAAACCTTTGTCGCAATAAGAATCCTGCACCCCCCTTAGATGCTGTTGAGCAAATTCTTCCTACTTTAGTTCGCCTCTTGCATCACGATGATCCAGAGGTATTAGCAGATAGCTGCTGGGCCATTTCCTACCTTACTGATGGTCCAAATGAACGGATTGAAATGGTCGTGAAAACAGGAGTTGTGCCCCAACTTGTGAAACTCCTAGGGGCTACTGAATTGCCAATTGTGACTCCTGCGCTAAGAGCCATAGGAAATATTGTCACTGGGACAGATGAACAGACTCAGGTTGTTATAGATGCGGGAGCACTTGCCATCTTTCCAAGCCTGCTAACGAACTCCAAAACTAATATTCAGAAGGAAGCTACATGGACAATGTCTAACATCACAGCTGGCCGCCAGGACCAGATACAGCAAGTCGTGAATCATGGATTAGTCCCATTCCTCATTGGCGTTCTCTCTAAGGCAGACTTTAAGACACAAAAGGAAGCTGTATGGGCTGTGACCAACTATACAAGTGGTGGAACGGTTGAACAGATTGTATACCTCGTTCGTTGTGGCATAATAGAACCACTGATGAACCTCTTAACTGCGAAAGATACCAAAATTATTCTGGTTATTCTGGATGCCATTTCAAATATTTTTCAGGTGAATCTTAACAAGGTGGAATTTATTTGAATTTGGGCTTGATAATTAG