Transcript asmbl_96846

Sequence
Transcript Sequence for observation asmbl_96846 of TGE0060096:
GGAACTTCCGGCATACGGAGACGCGCAACACTGTGTCCCGCGAGGAGCTCATGATGGTGCTGGCCAGCCTGGAGCAGCTGCAGATCCGTGCCCTCTTCTCACAGATCTCCTCGGCTGTCTTCCTGCGCAGGGTGGCACTGGAGGTGGCCAGCCCAGCAGGCCAGGGGGCCCTGGCCAGCAATGTGGAGCTGTGCCTGTGCCCCGCCAGCTACCGGGGGGACTCATGCCAGGAATGTGCCCCCGGCTTCTATCGGGACGTCAAAGGTCTCTTCCTGGGCCGATGTGTCCCTTGTCAGTGCCATGGACACTCAGACCGCTGCCTCCCTGGCTCTGGCGTCTGTGTGGACTGCCAGCACAACACCGAAGGGGCCCACTGTGAGCGCTGCCAGGCTGGCTTCGTGAGCAGCAGGGACGACCCCAGCGCCCCCTGTGTCAGCTGCCCCTGCCCCCTCTCAGTGCCTTCCAACAACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGCACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTGTGCGCCCGGATTCTTTGGGAACCCACTGGTGCTGGGCAGCTCCTGCCAGCCATGCGACTGCAGCGGCAACGGTGACCCCAACTTGCTCTTCAGCGACTGCGACCCCCTGACGGGCGCCTGCCGTGGCTGCCTGCGCCACACCACTGGGCCCCGCTGCGAGATCTGTGCCCCCGGCTTCTACGGCAACGCCCTGCTGCCCGGCAACTGCACCCGGTGCGACTGTACCCCATGTGGGACAGAGGCCTGCGACCCCCACAGCGGGCACTGCCTGTGCAAGGCGGGCGTGACTGGGCGGCGCTGTGACCGCTGCCAGGAGGGACATTTTGGTTTCGATGGCTGCGGGGGCTGCCGCCCGTGTGCTTGTGGACCGGCCGCCGAGGGCTCCGAGTGCCACCCCCAGAGCGGACAGTGCCACTGCCGACCAGGGACCATGGGACCCCAGTGCCGCGAGTGTGCCCCTGGCTACTGGGGGCTCCCTGAGCAGGGCTGCAGGCGCTGCCAGTGCCCTGGGGGCCGCTGTGACCCTCACACGGGCCGCTGCAACTGCCCCCCGGGGCTCAGCGGGGAGCGCTGCGACACCTGCAGCCAGCAGCATCAGGTGCCTGTTCCAGGCGGGCCTGTGGGCCACAGCATCCACTGTGAAGTGTGTGACCACTGTGTGGTCCTGCTCCTGGATGACCTGGAACGGGCCGGCGCCCTCCTCCCCGCCATTCACGAGCAACTGCGTGGCATCAATGCCAGCTCCATGGCCTGGGCCCGTCTGCACAGGCTGAACGCCTCCATCGCTGACCTGCAGAGCCAGCTCCGGAGCCCCCTGGGCCCCCGCCATGAGACGGCACAGCAGCTGGAGGTGCTGGAGCAGCAGAGCACAAGCCTCGGGCAGGACGCACGGCGGCTAGGCGGCCAGGCCGTGGGGACCCGAGACCAGGCGAGCCAATTGCTGGCCGGCACCGAGGCCACACTGGGCCATGCGAAGACGCTGTTGGCGGCCATCCGGGCTGTGGACCGCACCCTGAGCGAGCTCATGTCCCAGACGGGCCACCTGGGGCTGGCCAATGCCTCGGCTCCATCAGGTGAGCAGCTGCTCCGGACACTGGCCGAGGTGGAGCGGCTGCTCTGGGAGATGCGGGCCCGGGACCTGGGGGCCCCGCAGGCAGCAGCTGAGGCTGAGTTGGCTGCAGCACAGAGATTGCTGGCCCGGGTGCAGGAGCAGCTGAGCAGCCTCTGGGAGGAGAACCAGGCACTGGCCACACAAACCCGCGACCGGCTGGCCCAGCACGAGGCCGGCCTCATGGACCTGCGAGAGGCTTTGAACCGGGCAGTGGACGCCACACGGGAGGCCCAGGAGCTCAACAGCCGCAACCAGGAGCGCCTGGAGGAAGCCCTGCAAAGGAAGCAGGAGCTGTCCCGGGACAATGCCACCCTGCAGGCCACTCTGCATGCGGCTAGGGACACCCTGGCCAGCGTCTTCAGATTGCTGCACAGCCTGGACCAGGCTAAGGAGGAGCTGGAGCGCCTCGCCGCCAGCCTGGATGGGGCTCGGACCCCACTGCTGCAGAGGATGCAGACCTTCTCCCCGGCGGGCAGCAAGCTGCGTCTAGTGGAGGCCGCCGAGGCCCACGCACAGCAGCTGGGCCAGCTGGCACTCAATCTGTCCAGCATCATCCTGGACGTCAACCAGGACCGCCTCACCCAGAGGGCCATCGAGGCCTCCAACGCCTACAGCCGCATCCTGCAGGCCGTGCAGGCTGCCGAGGATGCTGCTGGCCAGGCCCTGCAGCAGGCGGACCACACGTGGGCGACGGTGGTGCGGCAGGGCCTGGTGGACCGAGCCCAGCAGCTCCTGGCCAACAGCACTGCACTAGAAGAGGCCATGCTCCAGGAACAGCAGAGGCTGGGCCTTGTGTGGGCTGCCCTCCAGGGTGCCAGGACCCAGCTCCGAGATGTCCGGGCCAAGAAGGACCAGCTGGAGGCGCACATCCAGGCGGCGCAGGCCATGCTTGCCATGGACACAGACGAGACAAGCAAGAAGATCGCACATGCCAAGGCTGTGGCTGCTGAAGCCCAGGACACCGCCACCCGTGTGCAGTCCCAGCTGCAGGCCATGCAGGAGAATGTGGAGCGGTGGCAGGGCCAGTACGAGGGCCTGCGGGGCCAGGACCTGGGCCAGGCAGTGCTTGACGCAGGCCACTCAGTGTCCACCCTGGAGAAGACGCTGCCCCAGCTGCTGGCCAAGCTGAGCATCCTGGAGAACCGTGGGGTGCACAACGCCAGCCTGGCCCTGTCCGCCAGCATTGGCCGCGTGCGAGAGCTCATTGCCCAGGCCCGGGGGGCTGCCAGTAAGGTCAAGGTGCCCATGAAGTTCAACGGGCGCTCAGGGGTGCAGCTGCGCACCCCACGGGATCTTGCCGACCTTGCTGCCTACACTGCCCTCAAGTTCTACCTGCAGGGCCCAGAGCCTGAGCCTGGGCAGGGTACCGAGGATCGCTTTGTGATGTACATGGGCAGCCGCCAGGCCACTGGGGACTACATGGGTGTGTCTCTGCGTGACAAGAAGGTGCACTGGGTGTATCAGCTGGGTGAGGCGGGCCCTGCAGTCCTAAGCATCGATGAGGACATTGGGGAGCAGTTCGCAGCTGTCAGCCTGGACAGGACTCTCCAGTTTGGCCACATGTCCGTCACAGTGGAGAGACAGATGATCCAGGAAACCAAGGGTGACACGGTGGCCCCTGGGGCAGAGGGGCTGCTCAACCTGCGGCCAGACGACTTCGTCTTCTACGTCGGGGGGTACCCCAGTACCTTCACGCCCCCTCCCCTGCTTCGCTTCCCCGGCTACCGGGGCTGCATCGAGATGGACACGCTGAATGAGGAGGTGGTCAGCCTCTACAACTTCGAGAGGACCTTCCAGCTGGACACGGCTGTGGACAGGCCTTGTGCCCGCTCCAAGTCGACCGGGGACCCGTGGCTCACGGACGGCTCCTACCTGGACGGCACCGGCTTCGCCCGCATCAGCTTCGACAGTCAGATCAGCACCACCAAGCGCTTCGAGCAGGAGCTGCGGCTCGTGTCCTACAGCGGGGTGCTCTTCTTCCTGAAGCAGCAGGTGCGCCAGGCACACCCGTCCTGCCATCCCCACTTGCACTGACCCTGCCCCACACTAACCCTGCCCTGTTTCTGCAGAGCCAGTTCCTGTGCTTGGCCGTGCAAGAAGGCAGCCTCGTGCTGTTGTATGACTTTGGGGCTGGCCTGAAAAAGGCCGTCCCACTGCAGCCCCCACCGCCCCTGACCTCGGCCAGCAAGGCGATCCAGGTGTTCCTGCTGGGGGGCAGCCGCAAGCGTGTGCTGGTGCGTGTGGAGCGGGCCACGGTGTACAGCGTGGAGCAGGACAATGATCTGGAGCTGGCCGACGCCTACTACCTGGGGGGCGTGCCGCCCGACCAGCTGCCCCCGAGCCTGCGACGGCTCTTCCCCACCGGAGGCTCAGTCCGTGGCTGCGTCAAAGGCATCAAGGCCCTGGGCAAGTATGTGGACCTCAAGCGGCTGAACACGACAGGCGTGAGCGCCGGCTGCACCGCCGACCTGCTGGTGGGGCGCGCCATGACTTTCCATGGCCACGGCTTCCTTCGCCTGGCGCTCTCGAACGTGGCACCGCTCACTGGCAACGTCTACTCCGGCTTCGGCTTCCACAGCGCCCAGGACAGTGCCCTGCTCTACTACCGGGCGTCCCCGGATGGGCTATGCCAGGTGTCCCTGCAGCAGGGCCGTGTGAGCCTACAGCTCCTGAGGACTGAAGTGAAAACTCAAGCGGGCTTCGCCGATGGTGCCCCCCATTACGTCGCCTTCTACAGCAATGCCACGGGAGTCTGGCTGTATGTCGATGACCAGCTCCAGCAGATGAAGCCCCACCGGGGACCACCCCCCGAGCTCCAGCCGCAGCCTGAGGGGCCCCCGAGGCTCCTCCTGGGAGGCCTGCCTGAGTCTGGCACCATTTACAACTTCAGTGGCTGCATCAGCAACGTCTTCGTGCAGCGGCTCCTGGGCCCACAGCGCGTATTTGATCTGCAGCAGAACCTGGGCAGCGTCAATGTGAGCACGGGCTGTGCACCCGCCCTGCAAGCCCAGACCCCGGGCCTGGGGCCTAGAGGACTGCAGGCCACCGCCCGGAAGGCCTCCCGCCGCAGCCGTCAGCCCGCCCGGCATCCTGCCTGCATGCTGCCCCCACACCTCAGGACCACCCGAGACTCCTACCAGTTTGGGGGTTCCCTGTCCAGTCACCTGGAGTTTGTGGGCATCCTGGCCCGACATAGGAACTGGCCCAGTCTCTCCATGCACGTCCTCCCGCGAAGCTCCCGAGGCCTCCTCCTCTTCACTGCCCGTCTGAGGCCCGGCAGCCCCTCCCTGGCGCTCTTCCTGAGCAATGGCCACTTCGTTGCACAGATGGAAGGCCTCGGGACTCGGCTCCGCGCCCAGAGCCGCCAGCGCTCCCGGCCTGGCCGCTGGCACAAGGTCTCCGTGCGCTGGGAGAAGAACCGGATCCTGCTGGTGACGGACGGGGCCCGGGCCTGGAGCCAGGAGGGGCCGCACCGGCAGCACCAGGGGGCAGAGCACCCCCAGCCCCACACCCTCTTTGTGGGCGGCCTCCCGGCCAGCAGCCACAGCTCCAAACTTCCGGTGACCGTCGGGTTCAGCGGCTGTGTGAAGAGACTGAGGCTGCACGGGAGGCCCCTGGGGGCCCCCACACGGATGGCAGGGGTCACACCCTGCATCTTGGGCCCCCTGGAGGCGGGCCTGTTCTTCCCAGGCAGCGGGGGAGTTATCACTTTAGACCTCCCAGGAGCTACACTGCCTGATGTGGGCCTGGAACTGGAGGTGCGGCCCCTGGCAGTCACCGGACTGATCTTCCACTTGGGCCAGGCCCGGACGCCCCCCTACTTGCAGTTGCAGGTGACCGAGAAGCAAGTCCTGCTGCGGGCGGATGACGGAGCAGGGGAGTTCTCCACGTCAGTGACCCGCCCCTCAGTGCTGTGTGATGGCCAGTGGCACCGGCTAGCGGTGATGAAAAGCGGGAATGTGCTCCGGCTGGAGGTGGACGCGCAGAGCAACCACACCGTGGGCCCCTTGCTGGCGGCTGCAGCTGGTGCCCCAGCCCCTCTGTACCTCGGGGGCCTGCCTGAGCCCATGGCCGTGCAGCCCTGGCCCCCCGCCTACTGCGGCTGCATGAGGAGGCTGGCGGTGAACCGGTCCCCCGTCGCCATGACTCGCTCTGTGGAGGTCCACGGGGCAGTGGGGGCCAGTGGCTGCCCAGCCGCCTAGGACACAGCCAACCCCGGCCCCTGGTCAGGCCCCTGCAGCTGCCTCACACCGCCCCTTGTGCTCGCCTCATAGGTGTCTATTTGGACTCTAAGCTCTACGGGTGACAGATCTTGTTTCTGAAGATGGTTTAAGTTATAGCTTCTTAAACGAAAGAATAAAATACTGCAAAATGTTTTTATATTTGGCCCTTCCACCCATTTTTAATTGTGAGAGATTTGTCACCAATCATCACTGGTTCCTCCTTAAAAATTAAAAAGTAACTTCTGTGTAACCGAATGAATGTTGACTTAAATACGGAGAGAGTGAGTCTCAAGACAG