Transcript asmbl_82986

Sequence
Transcript Sequence for observation asmbl_82986 of TGE0001383:
GCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCCTATCTCATTCCTTTCTTTCGATTACCCGTGGCGCGGAGAGTCAGGGCGGCGGCTGCGGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGTCTTGCCTTCTTCTTAGGTTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGACGGGAAAACAATCAAGCTTCAAATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAATGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAATTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCGAAGGAATTTGCTGATTCCCTTGGAATTCCGTTTTTGGAAACCAGTGCTAAGAATGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCCGGAGCAACAGCTGGTGGTGCTGAGAAGTCCAATGTTAAAATTCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCATCCTTTTCTCACAGCAATGAATTTGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAAGCAGTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTGATTCTTATGGTTAAAGGGAAATAGAGCCTTGCATTATATTCAACACAGCCATTTGTGTGTGCACAATGCAAACTAAGGTATTCTAGACCTATCTTAGAGCAGCATCCAGTATTTGCTTTCTAGATAATATGCCCAATAACATGACCTAGAGGGGCTTCTGTGCTGTGTAGGGATTTAACCAACTTCAGTGGTTCAGGGAGCTCAAACTATATGTAAAACAAGTTTAGAATGTATGCTATCTAGCCCGTTATCTCTGATCCTTCTCTAAAACCATTTGAAATAGCTTCATTGATCAACATTTCATAAATGCATCTGTGGTAGAGGTAGAAAGCAGCACCTTTCCTAATTGGCAAATGATCAGACTAATGTGTGCTAATGTTTTTCTTCCATGCTTTCAGTCAGATTCAACTATTTTATCCTCCACAGTTGCTTAACTTGGTGTTGGAGGAGGGTTTAAGCATTAAGATAGGAAGCAGGAAATTTGATTGCTCTAAATTTAGAAATTATATCCCTAAAAATTAAAACATGAATACTGGGTGGTAATGATAATTGAGGCAAATGTATTTATTTTGGTGACATTTTGCATATATGAAGATTTTCTGAAATAGGACCTTCAAGATCCTAGGGGGTTTTGTTTGGTTTTTAATTGTGAGGAATAAAAAATCTTCTGCCCACACTGGCATTTTAAGGTGACTGAGGTCAAACGTTGTTTCCTTAGGTTGAAATAGCAGCCAAAACATTCTTCACGCAGGGGCTTGGGATATGGCTGCTGGCAACACATTTTGTTGTGGGCTCCTTAATTTAATGATAAAATTTAAGCTAAACACAAGCCAAAAATGAATAGGTTTTTTTAATTTTTATTTTTCACTAAACAGGCAATTGAAATACATGGTACAAAAATAAGTGGTAAGATAATTGTAAAATGAAATGGACAGAATATTCAATTTTCCATCTATGAAAATTTCACAATAAAAATCATAGTTTACTTTGTATTATAGGCGTGCTTGGTGGATCTATTCATCCTCACATAAGGCAACTGACAAATT