Transcript asmbl_73969

Sequence
Transcript Sequence for observation asmbl_73969 of TGE0058231:
TGAGCAGCCTGCCACCTCCTCGGCCTCTCCCCTCCCGCCGTTGCCGTACCAGCCCACACCTTCGTCTCTGCATCTGTTCGTCCATTCCCATCACAGTTGCTGAGCGTCGGCCGCCACTCCCAGGGCCAGCAGGGCCCTGCCACTGTCAGGGTGTAGGTGTGCGGCACCAAGACCCCAGCCTGGGCCACTTCACACGCACAGGCAGGGGGCCGGAGGTCCCAAGTCCTGCCTTCTGGGGTGGCATCCTCACCACCCCCAGGGCAGATGAAGTCTCAGCACACCCAGGCTTTGCGACCCGGTCTGTGAACCTGGACACAGACACCCCGCACAGTGCTTTTAGAATTCAGATTTGGTCCGGCAGCCTCATCAGAGGGGCCCTGAGCGCCAGAGTTTGCTGCCATCCCCAGCCCACCCCTGCCGGGCTGACGGACTGAGAAGTGTGCAGCCTCAGCTCTGCACCTGGCGCCCCCAGGACAGGATACAGTCCCCTCTGTCCCACTCCAAATCCCAAAGGCAAGGAGAACCCCCCCCCCGACCCTCCACCAGTCCTGGGACTTGTCCTCAGTTCTGTAGCATCCAGCTGCCACCCCTGCTGTGGGCAGAGAGGTCGGGGAGGCCTCTGCCTTCCTTTGAGCTTCCGAGGTTGGGGAAAGGATGAAAGGGGCCCGTGCCGCCCCCGACCCCACGTGTCCCTGGCCATCTCCTTGTCCATGTTGCCTCTAACTCTGTGTTTCCCTCCCCTACGTGTCCCTTCCCCCTGCCCTCTGCATGTGACCCCGATCCCTCATCCTGGTCTCCACGCCGCCCCTCCCGCACACCTGCCTTCGGATGGCCCCGGCAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGGGTGGGTGGGCAGGGAGGG