Transcript asmbl_26226

Sequence
Transcript Sequence for observation asmbl_26226 of TGE0000944:
TCTTCACTCTCAGCTCCCTTCCCGGCGGCCTTTGCGGGAACAAGATGGCAGCCCCCATACCTCAAGGGTTCTCTTGTTTATCGAGGTTTTTGGGCTGGTGGTTTCGGCAGCCAGTTCTGGTGACTCAGTCCGCAGCTATAGTTCCAGTAAGAACTAAAAAACGTTTCACACCTCCTATTTATCAACCTAAATTTAAAACAGAAAAGGAGTTTATGCAACATGCCCGGAAAGCAGGATTGGTTATTCCTCCAGAAAAATCGGACCGTTCCATACATCTGGCCTGTACAGCTGGTATATTTGATGCCTATGTTCCTCCTGAGGGTGATGCACGCATATCATCTCTTTCAAAGGAGGGACTGATAGAGAGAACTGAACGAATGAAGAAGACTATGGCATCACAAGTGTCAATCCGGAGGATAAAAGACTATGATGCCAACTTTAAAATAAAGGACTTCCCTGAAAAAGCTAAGGATATCTTTATTGAAGCTCACCTTTGTCTAAATAACTCAGACCATGACCGACTTCATACCTTGGTAACTGAACACTGTTTTCCAGACATGACTTGGGACATCAAATATAAGACCGTCCGCTGGAGCTTTGTGGAATCTTTAGAGCCCTCTCATGTTGTTCAAGTTCGCTGTTCAAGTATGATGAACCAGGGCAACGTGTACGGCCAGATCACCGTACGCATGCACACCCGGCAGACTCTGGCCATCTATGACCGGTTTGGCCGGTTGATGTATGGACAGGAAGATGTACCCAAGGATGTCCTGGAGTATGTTGTATTCGAAAAGCAGTTGACAAACCCCTATGGAAGCTGGAGAATGCATACCAAGATCGTTCCCCCATGGGCACCCCCTAAGCAGCCCATCCTTAAGACGGTGATGATCCCTGGCCCTCAGCTGAAACCAGAAGAAGAATATGAAGAGGCACAAGGAGAGGCCCAGAAGCCTCAGCTAGCCTGATGACAAAAATGACTTCTAGGGTGAAGCCTGGGTGATGAGGCTGCTGGAAGCTTTGAAGTCTCCCATTCCCCTCATGCTATAAAAAGAACTACCTTTGTTCTCTCCCATCCTGCTCAGGTCTTTTCAGCAGTCTCATCATCAGCAACCATGACTGATGACTGGGCCCTAGCAGGTGGCAGGTATAACATGGCCATGGACACTCTTCTTTTTTAAATTTTATGTCTAGCTTCTGAGTCTAGATGAAAGACAGTATGTTTCAGAGAACATTGGATATCAGTTTTTCCCACAGCAGGGACTGTGAGAGACAACCAGCAGCATCCTCTTTGTAATCACAGGGCAGGGATCAGAGTTTGAAATGAAATGTTGTCAGGGTGTTGGAAAAATTTTGGTGAGTTCTGCACATTTCCCCTGGTTCAGGCTGGGCATGGACCAGCCTTCAGATGGCAGAAGTGGAAGATGAGCCTACTTGTGAGCGATGTGACTTTAAGGAAATGAAGACTGGGGAAGAATAATTAGTGTTTATAAGACATTTAAGAGGCCCTTTTTCATATACTGACTCACTGATGAATCAGCATTTGCATTTTATGGAAAAATATAAATCCAAAGAAATAATTTATCC