Transcript asmbl_59333

Sequence
Transcript Sequence for observation asmbl_59333 of TGE0056243:
AAGTGCCTTCCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGGCGCGAGTATGACCACAATGGCGGCCGCCACCCTGCTGCGCGCGACGCCCCACTTCAGCGGTCTCGCCGCCGGCCGGACCTTCCTGCTGCAGGGTCTGTTGCGGCTGCTGAAAGCCCCGGCATTGCCTCTCTTGTGCCGCGGCCTGGCCGTGGAGGCCAAGAAGACTTACGTGCGCGACAAGCCACATGTGAATGTGGGTACCATCGGCCATGTGGACCACGGGAAGACCACGCTGACTGCAGCCATCACGAAGATTCTAGCTGAGGGAGGTGGGGCTAAGTTCAAGAAGTACGAGGAGATTGACAATGCCCCGGAGGAGCGAGCTCGGGGTATCACCATCAATGCGGCTCATGTGGAGTATAGCACTGCCGCCCGCCACTACGCCCACACAGACTGCCCGGGTCATGCAGATTATGTTAAGAATATGATCACAGGCACTGCACCCCTCGACGGCTGCATCCTGGTGGTAGCAGCCAATGACGGCCCCATGCCCCAGACCCGAGAGCACTTATTACTGGCCAGACAGATTGGGGTGGAGCATGTGGTGGTGTATGTGAACAAGGCTGACGCTGTCCAGGACTCTGAGATGGTGGAACTGGTGGAACTGGAGATCCGGGAGCTGCTCACCGAGTTTGGCTATAAAGGGGAGGAGACCCCAGTCATCGTAGGCTCTGCTCTCTGTGCCCTTGAGGGTCGGGACCCTGAGTTAGGCCTGAAGTCTGTGCAGAAGCTACTGGATGCTGTGGACACTTACATCCCAGTGCCCGCCCGGGACCTGGAGAAGCCTTTCCTGCTGCCTGTGGAGGCGGTGTACTCCGTCCCTGGCCGTGGCACCGTGGTGACAGGTACACTAGAGCGTGGCATTTTAAAGAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGTTTGGGAAGCCAGTCTGGAGAGCAGGGCCTGGCTGAAGGGTGGCCTTACCCCGGCAGATCCCTTGTGCCTTCCCTCTGTCTCACATTCGCCTTCCTTCTCCCTGCTCCTTTTCCCTTTCCGTCCTAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTCACCCTGCGAGATGGCAACCGGACTATTGGCACCGGTCTAGTCACCAACACGCTGGCCATGACTGAGGAGGAGAAGAATATCAAATGGGGTTGAGTGTGCAGATCTCTGCTCAGCTTCCCTTGCGTTTAAGGCCTGCCCTAGCCAGGGCTCCCTCCTGCTTCCAGTACCCTCTCATGGCATAGGCTGCAACCCAGCAGAGGGCAGCTAGATGGACATTTCCCCTGCTCGGAAGGGTTGGCCTGCCTGGCTGGGGAGGTCAGTAAACTTTGAATAGTAAGCCAGCCTGTGTCCTGTGTCCTTTGTGCAAATTGGAGAGGATAGGGGAGGACAAAAAGGGTGTTGAACCCCAGACAGATGGGGAGCTTGTGAGATCCCAGAGCAGTTTTAACGGATAAATCAAGTCCAGTGAGCTTAGTGATTGCCTAGACACAGTAGGATGCCGTTATTCAGCCTCCTGGGAGATAGTGGGAAAGAATGTTCTATCGCTCTGGAGCCAGCATGGCTTCAGCTCAGGTGCCAAACCCATCTTGTTTCCTCGGAATACTAAGTGAATGTCTAGCATCCATTCACATTCTGTGGGAACAGGGACTGGACAGGCATACCTCAGATGCTGTAGGTTTGCTTCCAGACTACCAC