Transcript asmbl_54715

Sequence
Transcript Sequence for observation asmbl_54715 of TGE0000590:
CCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATGCTCCCCAGGTTCATCCTGTGTCGTCTCCCCCACCTACCAGTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTG