Transcript asmbl_29495

Sequence
Transcript Sequence for observation asmbl_29495 of TGE0004684:
CTGCGGCTGAGGGGCAAGATGGCTGCCGAGAAACAGGTACCTGGAGGCGGCGGCAGCGGCGGCGGCGGGGGCAGCGGTGGCGGCGGACGCGGTGCCGGAGGAGAGGAGAATAAGGAAAACGAACGGCCATCCGCCGGATCGAAGGCAAACAAAGAATTCGGGGATAGCCTGAGTTTGGAGATTCTTCAGATTATTAAGGAATCCCAGCAGCAGCATGGCTTACGGCATGGAGATTTTCAGAGGTACAGGGGCTACTGTTCCCGCAGACAGAGACGGCTCCGGAAAACGCTTAACTTTAAGATGGGGAACAGACACAAATTCACAGGGAAAAAAGTAACCGAAGATCTTCTGACCGATAACAGATATTTGCTTCTGGTTCTGATGGATGCTGAAAGAGCCTGGAGCTATGCCATGCAGCTCAAACAGGAAGCCAACACTGAACCCCGAAAACGGTTCCACCTGTTGTCTCGCCTGCGGAAAGCTGTGAAGCATGCCGAGGAATTGGAACGCTTATGCGAGAGCAATCGCGTGGACGCCAAGACCAAGCTAGAGGCTCAGGCTTACACAGCTTACAAAAAAAAAAGAACATCAAGAGTGGAAAGCTGCCATTGAGGCTTTTAATAAATGCAAAACGATCTACGAGAAGCTCGCCAGTGCTTTTACAGAAGAGCAGGCCGTGCTGTACAGCCAGCGTGTGGAGGAGATCTCGCCCAACATCCGCTACTGCGCGTATAACATTGGGGACCAGTCAGCCATCAATGAACTCATGCAGATGAGATTGAGGTCTGGGGGCACCGAGGGTCTCCTGGCTGAAAAATTGGAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGCTGGAGACTGTGCCCATTTTTTACACGTCCTCACTCAACATCGGTCCCAG