Transcript asmbl_49636

Sequence
Transcript Sequence for observation asmbl_49636 of TGE0000497:
CTTATCTCGTTCGCGCGTCTCGCGAGCATTAGGTGACTGGCTGAGGCGGCGCCAGTTGGCCGGGCACGGGGCTGCTGTAAGGCCGAGGTTGCGGCGGAAGCGGAGACCATGTTCCGAGCGGCGGCTCCGGGGCAGCTCCGGCGGGCGGCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAAGATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAGAACCTTTTGCCCAGAGTAGCAGCCAAACTTGAGGTTGCCCCGATTTCTGACATCATTGCAATCAAGTCACCTGACACATTTGTGAGAACTATTTATGCAGGAAATGCTCTATGTACAGTGAAGTGTGATGAGAAAGTGAAAGTGTTTTCTGTCCGTGGAACATCCTTTGATGCTGCAGCAACAAGTGGCGGTAGTGCCAGTTCAGAAAAGGCATCAAGTACTTCACCAGTGGAAATATCAGAGTGGCTTGACCAGAAATTAACAAAAAGTGATCGACCAGAGCTAACAGGTGCCAAAGTGGTGGTATCTGGTGGTCGAGGCTTGAAGAGTGGAGAGAACTTTAAGTTGTTATATGACTTGGCAGATCAACTACATGCTGCAGTTGGTGCTTCCCGTGCTGCTGTTGATGCTGGCTTTGTTCCCAATGACATGCAAGTTGGACAGACGGGAAAAATAGTAGCACCAGAACTTTATATTGCTGTTGGAATATCTGGAGCCATCCAACATTTAGCTGGGATGAAAGACAGCAAGACAATTGTGGCAATTAATAAAGACCCAGAAGCTCCAATTTTCCAAGTGGCAGATTATGGAATAGTTGCAGATTTATTTAAGGTAGTTCCTGAAATGACTGAGATATTGAAGAAAAAATGAATCAGGATCATGCCTTAAAAAGAAAACTTTTGTTAAAGTATTCCACTGAAATCACAGATATTTGTGGGTATTATAACAATCATTGGAAAGCATGGAGAGCTACATTTCATAATTTGAGGGAAAATTTCTAACAGATGCCAGAATGCTTGTTTATGGGATTGCTGTGTTTCCTTTTAATTATTTGTGGTTCCAAACAATTATTGTTTGAACTTTTTAAATTCTGTACTAAAATCTATAATAAAGCTTTTCCACAGCTTTAAAACTATCAGAAATATGCCTAGCCTCTAGAGAAAATTGAAGAAAAGGAGTAAAAATTTTGTTTATTTATTTATTTTTTTGCCTTTCTTGTTCATGGAGAGCTCTATGTTTTAGGAAGATTGTAAACATGATTGTCTCCACCAGCCTAATCAACCTACTAATCTCATTGTTGAAGGGCAAACTTCATAGGAGAAGGTAACTGAATTGGCAAGTGCAGAGTTAAAAAAGCACGGCTATAAAGCATGAATATTATCTTAAACATACTCCAGTCTTCAGAAGACCATAGCTAATGTGACAAAAGCAGACCTGACTTAAACCTGACCCAGCTCCATGTATTTAGTTGGCTTAAGGTAAATTTCATTTTCCGTTTAATTTTAAGGTTTTGTCAGTTTATAGGACTTTTGTCTGTAAAGGAGGGAGAGTGGAGGAGGGGCTGCTTTGAGACAGCATGGCCTCTGATGCAAGCA