Transcript asmbl_39535

Sequence
Transcript Sequence for observation asmbl_39535 of TGE0060027:
CTGTCAATTGATGTCCACTAGTTGTTAATTATCGTTGTTAAAATACAAGCTTCAGGAGTGCCCGTATGTTGGTGGTAAAACTGTTGCATTTCAGACCTCAGAGTTCCAAATAATTTGTTGAATGAGGAACCCTGGTAAGTTTAGATTGGTAGTGAATATTTTTGGAGAATTTAGTAAGCAAAGAAGCAATTTTGAGTTAATAACTAATTTCTTTTTCTAGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACCTCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAGATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCGCTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATGAATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACAAAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCATATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTGGATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCAAATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCTACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAACGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCTGAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTGGAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTGGTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATTCACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAACAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACTGTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCTGTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCTAAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGACCTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATGAGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAGCGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATCATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACCCCTGTTAAGCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAGCAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTGGAATCTGTTTATCGGTGCCCATTATATCCTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATTTGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAACAATTA