Transcript asmbl_29441

Sequence
Transcript Sequence for observation asmbl_29441 of TGE0004671:
GCCTTCCGCTGAGGCGCGCGCTTTGCTCTCATCCTGTTCGGGATCATGGCGGCCACGGCCACGATGGCGACCTCTGGCTCGGCGCGGAAGCGTCTGCTCAAAGAGGAAGACATGACCAAAGTGGAATTCGAGACCAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTACGCGGCATCTACGCCTACGGATTTGAAAAACCGTCGGCAATCCAACAGCGAGCCATCAAGCAGATAATTAAAGGGCGAGATGTCATCGCACAGTCTCAGTCTGGCACAGGCAAAACTGCCACCTTCAGTATTTCCGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAGACCCAGGCTTTGATTTTGGCCCCAACGAGAGAGCTGGCTGTGCAGATCCAGAAGGGCCTGCTCGCTCTGGGTGACTACATGAACGTCCAGTGTCACGCCTGCATCGGGGGCACCAACGTGGGGGAGGACATCAGGAAGCTGGACTATGGACAGCACGTGGTCGCCGGCACGCCGGGCCGTGTCTTTGATATGATTCGTCGCAGAAGTTTAAGGACACGTGCTATCAAGATGCTGGTTTTGGATGAGGCCGATGAAATGCTGAATAAAGGTTTCAAAGAGCAGATCTACGACGTGTACAGGTACCTGCCCCCGGCCACGCAGGTGGTGCTCATCAGCGCCACGCTGCCCCACGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCCTGGTGAAACGTGACGAGCTGACTCTAGAAGGCATCAAGCAGTTTTTTGTGGCGGTGGAGAGAGAAGAGTGGAAATTTGACACTTTGTGCGACCTCTACGACACGCTGACCATCACACAGGCTGTCATCTTCTGCAACACCAAAAGGAAGGTTGACTGGCTGACAGAGAAGATGAGAGAAGCCAACTTCACCGTGTCGTCGATGCATGGGGACATGCCACAGAAGGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCTGGTGCCAGCCGCGTGCTCATTTCCACCGACGTCTGGGCCCGGGGGCTGGACGTCCCTCAGGTGTCCCTCATCATCAACTATGACCTGCCCAACAACAGAGAGCTGTACATCCACAGGATCGGCCGGTCGGGCCGGTACGGCCGGAAGGGCGTGGCCATCAACTTCGTAAAGAACGATGACATCCGCATCCTGCGGGACATCGAGCAGTACTACTCCACGCAGATCGACGAGATGCCCATGAACGTTGCCGACCTGATCTGAGGCGCCCGCCGGGGTCCCGCAGCCACGGGGGCCGTTCCGGGCCGGTCCTCGTTCCTGGAGTCATGTGGACTCTCCTCACAGAGTCCCCGCAGTTGGAGTCATGTGGATTCTCCTCACAGAGTGCTGGTGGTGGTAGAGGTTCTTCCTTTTCTTACTTATGTGTAAATAGCGCTTTGCTTTATGTGTTTTTCATTAAACGCTTGAAACTCTTCCGTTGAA