Transcript asmbl_39388

Sequence
Transcript Sequence for observation asmbl_39388 of TGE0056195:
GAGTTTGTGGGTCAGAGTTTGTGGGTCAGAGTTTGTGGGGCTGGGATAGAAACTCGGGGGATTGGCGTTCAGATGCTGACCACTTCCCTCTTCTCTGAGCAGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGGTAAGAGGTGAACTGCGCTTTCTCAGAGAAAGCAGCCATATGGGGCAGGTCAAGTATAGTGTCTGGGGCTTTCCCTATCCCTGGACTTGGGCTCCAAAAAGAGCCAGGAGGCAAGGTGCAGGGCCCTGCCCAGCCCAGCCCAGGAGTGGGAGGTCAGGGCGGTATAACAGGAAAGGAAGGGGGTAGTATTGTAGAGGGTGGGAAGGAATGAGAAGTGAAATAATGGAATGTCTGTCCCCACTGCCTGACCCCTCACCCCATGTCTTTGTCTTGTCTTCACCATGAATGTCTCTTCCTTCCTGCAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGGTACGGCTCCTCCCAGCCTCTCCTCTAGTTGATCTCCCCAGTGTTTCTTTTTTCCCCAACCTGTGCTCTTTATCCCCTGCCCTTACCCTACTACCATCTGACTTCCTCCTGGCATGTTTCTGCATGGAGCTGACTAGGGAGGGGAGGGATTCCTCAAAGAGGAAGACAACCTGGGGGTACAGTACCTCCTTACCTCTAGAATGGGCCCTGAGGTTTTACTTATGCGGCCCTGGGTGCTGGTGTCTGGGAACTCTCACCAGCCTGTATACCAGTCTTGCTTTAGGGTGACCTTCTGGCCCTGGAGCATGGGTAGCTGGCATAGAGGGGTATGGGTTGCCTGCCCCATTCTGCTGCTATAGCTGAACAGTCCTTTCCCCTTCCCTCGCTGGGCAGCTTGGAGGTACCCTAACCCAAAACTCTGTCCTCTCCTCCCGCCAGTGGCTGACAGTAGCTGTAGGTGTAGTGGAGAACTTTTCTGCCTCTGCTGTGTTCTTGCTGCTTAGGTTTGGGTGGGGGACTAACAGCTGCTGGGAGGGGAGCTAGGGGCATGGAGAACTGGTCAGACTCAAGGTGGCTCCTCTGCAAACTGACCCCAGGGTTGGTTGCTGTGGGCATGTTCCCGCTTATGCTACCTTTGCAGTCTGGTAGTCCCCTGGCCCTTGGCGTACCCCTCCACAGCCCTGTTCCCTGGCTCATCCCACCTTTCCTTTCCACAGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTC