Transcript asmbl_29413

Sequence
Transcript Sequence for observation asmbl_29413 of TGE0004667:
ATCATTCGTGTTCAGTCCCCGGATGGGGTGAAGCGGATCACGGCAACAAAGAGAGAGACAGCTGCGACGTTCCTGAAGAAGGTCGCAAAGGAGTTTGGCTTCCAGAATAATGGCTTCTCAGTTTACATCAATAGAAACAAGACCGGAGAGATAACAGCATCGTCCAACAAATCCCTCAACCTGCTAAAGATCAAGCATGGCGACTTGTTGTTCCTATTTCCCTCGAGCCTTGCCGGACCGTCATCTGAGATGGAGACGTCCACCCCGCCGGGCTTGAAGGCCCTGGGCGCGCCCACCGTGGTGGAAGATGAGATCGACCAGTACCTCAGCAGGCAGGACGGCAAGATCTACAGGAGCCGCGACCCGCAGCTATGCCGACACGGCCCTTTGGGGAAGTGCGTGCACTGCGTCCCTCTAGAGCCATTCGATGAGGACTACCTAAACCATCTCGAACCGCCCGTGAAGCACATGTCCTTCCACGCCTACATCCGAAAGCTGACCGGAGGGGCTGACAAGGGGAAGTTTGTCGCCCTTGAGAACATCAGTTGCAAGATTAAATCAGGGTGCGAGGGACACCTTCCGTGGCCTAATGGCATCTGTACTAAGTGCCAGCCGAGTGCCATCACGCTGAACAGACAGAAGTACCGACACGTGGACAACATCATGTTTGAGAACCACACGGTCGCTGACCGCTTCCTCGACTTCTGGCGGAGGACGGGGAGCCAGCATCTCGGGTACTTGTACGGGCGCTACACGGAGCACAAGGACATCCCTCTCGGCGTCAGGGCCGAGGTGGCGGCCATTTATGAGCCTCCTCAGATTGGTACACAGAACAGCTTGGAGCTCCTTGAAGACCCAAAAGCCGAGGTGGTGGATGAGATCGCTGCCAAACTTGGCCTGAGGAAGGTTGGCTGGATATTTACGGACCTTGTCTCAGAGGACACCCGAAAGGGCACAGTCCGATACAGCCGGAATAAGGACACCTATTTCTTGAGTGCAGAAGAATGTATCACTGCAGGAGACTTCCAAAATAAGCACCCCAACATATGTCGGCTCTCTCCAGACGGACACTTTGGATCCAAGTTCGTTACTGCTGTGGCTACAGGTGGCCCCGACAACCAGGTCCACTTTGAAGGGTACCAGGTGTCCAATCAGTGCATGGCGCTGGTCCGTGACGAGTGCCTGCTGCCGTGCAAGGACGCCCCTGAGCTCGGCTACGTCAAGGAGTCCAGCAGTGAGCAGTACGTGCCCGATGTGTTTTATAAGGACCTAGACAAGTTCGGCAACGAGATCACCCAGCTGGCCCGGCCCCTGCCCGTGGAGTACCTGATCATAGATATCACAACAACTTTCCCCAAGGATCCAGTTTATACTTTTTCTATTTCGCAAAATCCGTTTCCTATTGAAAACCGGGATGTGCTGGGTGAGACACAGGACTTCCACAGTTTGGCCACCTACTTGTCCCAGAGTACCTCAGCTGTATTTTTGGATACCATCTCGGATTTCCACCTCCTGCTGTTTCTGGTCACCAATGAAGTCATGCCTCTGCAGGACAGCATCAGCTTGCTGCTGGAGGCCGTGAGGACCAGGAACGAGGAGCTGGCGCAGACCTGGAAGAAGTCTGAGCAGTGGGCCACCATTGAGCAGCTCTGCAGCACAGTCGGAGTGCAGCTTCCGGGCCTCCAGGAGTACGGTGCCGTTGGGGGCCCCTCGCACGCCGCCGCGGCCGCCATGTGGGCCTGTCAGCACTGCACCTTCATGAACCAGCCGGGCACTGGCCACTGTGAGATGTGCAGCCTCCCCAGGACCTAGGGCTTCTGCCCCTGTGGCGGGGCCGGGCCCCTAGCCCTCCCTGAAGCCAGGACCTTTGTGACCGTGCCCCTTGGGCAGCCCTGAGGGGCGAGGCAAGGTAGCTGCCCCCCGGGTTCCTGATCCACAAGGCTTCTCAGCATCAGGCTTCCCTGGAGGAGGGCCCGGCTGGTGCTCTGCCAGCTGCTGGCAGCCACCTCGGGCAGGCGCAGCCCAGACACCTCTGGTGTCAGCCCCACCGTGGTGGAGGGACTGGCACCCCATCTTCACCCGGAGCGGAGGGGCGGGGCGCTCGCTGCTGCCTTGGCCTCCTTTCTCCTTCTGGATGCTTTCTGTTCTTGCCTCCCCCTGGTTTGGTGGGGGTCCCCCTTGGCCTCTCCATCCTGCTGCTCTGGGGCAGACCCTACCCTGAGGCCACTTCCTCCCTTCCCGGAGCCATCATCCGGTGGAAGTGCGAGTGGCCTCCGGCTCGCTGGCCTCCCTCTGCTTGATCTGCAGGTTGATTTGCTGCCCACCCTCTCTCCTGCTCCCGCCTGCCGTTCAGGTGGGATTTTAAAGTCGGCATTGGTTGTAATAACAGTTATTAGTAATTTCTGCCCAGAAGACTTTTATTTATTTTTTTTAAGATAAAAAATGCATAAAAGGGGAGTGAGAGAGACTAGTTTCCTCTTCCTTCTCTCCTCTAGTGAGTCCCCGTGGGTGTGTGCAGGGCGGGTGAGTGTGGCAGGGGACTCACAGTCAGTTCTCCATGGAAGCTAACCTCAGTGCCTGAGACTTTTCTGCCAAGCCACACAGCTGCAGGTACGGGCCGACCCAGCAGGAGTGGCGCGGTGGCTCCACCAGGCAGGTGGCTCCACCAGGCAGATGGCCCCTGCAGACGGCTGATGCCCCTGACCAGGCCCACATGGGGTGAGCCGAGTTAGCCAAGGTCAGAGCTCGGGTTCCCTTTGCCCCACACAGTCCCATAGCCCTGCCTGGCCCCTGGTCTCTGGCACAGTGACGTGGCCATCAAGAAAAGGAGCAGGGGCTTGACCTGTCGTGAGCGCACATGGGTCGGCTGTGGGGGCATCGGCAAGTTGCTGCTGTGCTGATGGAGTGAGGTCCGCACCCTCCCAGGACAGAGATCTGGGCAGACCTCGCACATGTGCCCTGTGGTCCCGCATTCTCTCCACGGCTGGGGTGTGTTCAGGCCCTTCCCCAGGGACTCGTGGGCATGCTGATGCCTCTTTGCCTTAACAAGAGCCGTATCTCTGAGCTGCCCCGCACCCATGGGAGAGGCCAACCAAACAGACTGCTTGGGGACTTCGGGTCTGCCCTGGGTTGGGGGCCAGCCTGTGGGACCCTCCCTTTCCCTCGGGGCTGTGCACAGAGCACTGAGTGTTGGCTTCTGCCCTAGTAAGGGCCACATCAGGCACCTCCGGGTCCACCCACCCAGACTCGTCTGCTCTTGGGGCCAGGGGCCAACTCGGCTGGGTCTGGCGGTGGCAGAGCAGCTGACCTGGAGGGGCCGGAAGGGCAGAGCAGCCCGGCAGAAGCGCAGCAGCCTGGCGAGGACTGGCTGGGGGCACTCTCAGCAGGTGCCCTGGCTGGAGCTCCTGCCTCATCTTCTGGTCCCTGCAATCAGATGCGAGGCCGCGCTGGGCCCTGCGTTCGGCCTGTCCCCCGGCGCCGGGGGAGGCCGGAGGTACCGGCTTCGAGAGCACCGGCCCCCCTCCCGCCTGCTCTGTCATCACCAAGCTAGTTTCGTTTTCAACCAATACTTCACTCGGAAGCTCTGGCATCGCATCATTCATTTGTTTCCTTCTGTCTTTTAGCTAAAGAAAAAGCTTTGTTGTGATT