Transcript asmbl_30788

Sequence
Transcript Sequence for observation asmbl_30788 of TGE0000090:
CGGAGCTGGGGCGCCCTCCGGAAGCGTTTCCAACTTTCCAGAAGTTTCTCGGGACGGGCAGGAGGGGGTGGGGACTGCCATATATAGATCCCGGGAGCAGGGGAGCGGGCTAAGAGTAGAATCGTGTCGCGGCTCGAGAGCGAGAGTCACGTCCCGGCGCTAGCCCAGCCCGACCCAGGCCCACCGTGGTGCACGCAAACCACTTCCTGGCCATGCGCTCCCTCCTGCTTCTCAGCGCCTTCTGCCTCCTGGAGGCGGCCCTGGCCGCCGAGGTGAAGAAACCTGCAGCCGCAGCAGCTCCTGGCACTGCGGAGAAGTTGAGCCCCAAGGCGGCCACGCTTGCCGAGCGCAGCGCCGGCCTGGCCTTCAGCTTGTACCAGGCCATGGCCAAGGACCAGGCAGTGGAGAACATCCTGGTGTCACCCGTGGTGGTGGCCTCGTCGCTAGGGCTCGTGTCGCTGGGCGGCAAGGCGACCACGGCGTCGCAGGCCAAGGCAGTGCTGAGCGCCGAGCAGCTGCGCGACGAGGAGGTGCACGCCGGCCTGGGCGAGCTGCTGCGCTCACTCAGCAACTCCACGGCGCGCAACGTGACCTGGAAGCTGGGCAGCCGACTGTACGGACCCAGCTCAGTGAGCTTCGCTGATGACTTCGTGCGCAGCAGCAAGCAGCACTACAACTGCGAGCACTCCAAGATCAACTTCCGCGACAAGCGCAGCGCGCTGCAGTCCATCAACGAGTGGGCCGCGCAGACCACCGACGGCAAGCTGCCCGAGGTCACCAAGGACGTGGAGCGCACGGACGGCGCCCTGCTAGTCAACGCCATGTTCTTCAAGCCACACTGGGATGAGAAATTCCACCACAAGATGGTGGACAACCGTGGCTTCATGGTGACTCGGTCCTATACCGTGGGTGTCATGATGATGCACCGGACAGGCCTCTACAACTACTACGACGACGAGAAGGAAAAGCTGCAAATCGTGGAGATGCCCCTGGCCCACAAGCTCTCCAGCCTCATCATCCTCATGCCCCATCACGTGGAGCCTCTCGAGCGCCTTGAAAAGCTGCTAACCAAAGAGCAGCTGAAGATCTGGATGGGGAAGATGCAGAAGAAGGCTGTTGCCATCTCCTTGCCCAAGGGTGTGGTGGAGGTGACCCATGACCTGCAGAAACACCTGGCTGGGCTGGGCCTGACTGAGGCCATTGACAAGAACAAGGCCGACTTGTCACGCATGTCAGGCAAGAAGGACCTGTACCTGGCCAGCGTGTTCCACGCCACCGCCTTTGAGTTGGACACAGATGGCAACCCCTTTGACCAGGACATCTACGGGCGCGAGGAGCTGCGCAGCCCCAAGCTGTTCTACGCCGACCACCCCTTCATCTTCCTAGTGCGGGACACCCAAAGCGGCTCCCTGCTATTCATTGGGCGCCTGGTCCGGCCTAAGGGTGACAAGATGCGAGACGAGTTATAGGGCCTCAGGGTGCACACAGGATGGCAGGAGGCATCCAAAGGCTCCTGAGACACATGGGTGCTATTGGGGTTGGGGGGGAGGTGAGGTACCAGCCTTGGATACTCCATGGGGTGGGGGTGGAAAAACAGACCGGGGTTCCCGTGTGCCTGAGCGGACCTTCCCAGCTAGAATTCACTCCACTTGGACATGGGCCCCAGATACCATGATGCTGAGCCCGGAAACTCCACATCCTGTGGGACCTGGGCCATAGTCATTCTGCCTGCCCTGAAAGTCCCAGATCAAGCCTGCCTCAATCAGTATTCATATTTATAGCCAGGTACCTTCTCACCTGTGAGACCAAATTGAGCTAGGGGGGTCAGCCAGCCCTCTTCTGACACTAAAACACCTCAGCTGCCTCCCCAGCTCTATCCCAACCTCTCCCAACTATAAAACTAGGTGCTGCAGCCCCTGGGACCAGGCACCCCCAGAATGACCTGGCCGCAGTGAGGCGGATTGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGCATCGTGTCTGGCGTTGTGGGGATGAACTTTTTGTTTTGTTTCTTCCTTTTTTAGTTCTTCAAAGATAGGGAGGGAAGGGGGAACATGAGCCTTTGTTGCTATCAATCCAAGAACTTATTTGTACATTTTTTTTTTCAATAAAACTTTTCCAATGACATTTTGTTGGAGCGTGGAAGAAGATTGGATCAGGAGATTCTTACACCATTCTTCCCAGGGGACAAGGTCTCCTGTTAAGGCAGACTCGCTACTGATGGCTCATATCAGGCCCTGGAATGCTGGCAGATCGCTGGCAGATCACTGTGCAGACAGCGCCAAGTGGCAGGTGCATTCCGTGCTGACCCGGGAAATGGTTCTGGCTCTGGCAGCCCTGGAGAAGTAGCAGCTGCAGGACCTGAATGAGAGCACTGGACCTGGAGCCAGTCTTCAGCCTCTTCGCCTTTCTTTCTTTACCCTTTTTTTAAGATGTGAATCTTGCTATATTGCCCAGGCTGGTCTTGAACTCCTGAC