Transcript asmbl_23892

Sequence
Transcript Sequence for observation asmbl_23892 of TGE0056759:
CCCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGGCATAAGTAGTGCCGGAAAGTTAGCTGCCGAGACCTGGTGGATTGCTTTTCGTTTATCAGTGCAGGAAAACAGCGCTATAGTATGCGTCACAACTAGCGCAGACTCCGGCAGTATTTAGGCGGTGCGGCTTGGGAACTAGAATCCACTTCCTGTCTTCCGCCTCAGGCTAGAGGGCGAGCGCTTCGCCGTGGGACTTCTTCTGCCTGGCTCCGCCTTTTGCCCCGGAAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGGTAAGCTTCAGGGGTGTGAAGTCGCCGGCGTTCTTGGGTTTGAGGACTCAGTGGGGAGAGCCTTCGGCGGGAGCGCTCCTTGGCCTGCCGGCCTCGGTTGCAGGGCGGGCGCGGTTATTGCTTGGCCCATGTGCTCTGGTGGTGGAGTTTGCGGGGGCTGAGGGCGCAGTATTAGGGGACTTTGGCGCTATTTGAGGACCTGGTTGCATTCCCGCTGCCCTCCTACAGCCGCCTAAGGACGACAAGAAGAAGAAGGACGCTGGAAAGTCGGCCAAGAAAGACAAAGACCCAGTGAACAAATCCGGGGGCAAGGCCAAAAAGAAGGTAGAAATAAGACCTCTCTGAAAGAGACTAGGGGTAACTCTCTCGTAATCCTCTAGTAATAGGTAACTTGTATAGTAAGTGGTTTTTCAGGTGTAGATTTCTAGAGTCAAAATGTGAGAGTTTATCTTCCCGTCACCACTCGTTCTTTTTCCCATTAGGATCATGAAAATGGGTCTGTTGTGCGAAGTGTCTGCCGCTGTGCCTGCTGTGTTATTTTTAACTGATCTAGTGGGGCTCGGCCCCTGTTTGAAGGCCAAAAACGTGTCGGTGTTTTTTTTTTGTTTTTGTTTTAGTAATGTGTAATTTATCCTTGATAACGGTGGAACAGATTTCTCTGACGCAGATTACTCGAGAGGGAAAGGGTGCTTCTGCCAGAAATACTAACTTGTTTCTGTTTTGTTTTGGTGAGCAGAAGTGGTCCAAAGGCAAAGTTCGGGACAAGCTCAATAACTTAGTCTTGTTTGACAAAGCTACCTATGATAAACTCTGTAAGGAAGTTCCCAACTATAAACTTATAACCCCAGCTGTGGTCTCTGAGAGACTGAAGATTCGAGGCTCCCTGGCCAGGGCAGCCCTTCAGGAGCTCCTTAGTAAAGGACTTATCAAACTGGTTTCAAAGCACAGAGCTCAAGTAATTTACACCAGAAATACCAAGGGTGGAGATGCTCCAGCTGCTGGTGAAGATGCATGAATAGGTCCAACCAGCTGTACATTTGGAAAAATAAAACTTTATTAAATCA