Transcript asmbl_26100

Sequence
Transcript Sequence for observation asmbl_26100 of TGE0000942:
GTCATCTGGAGCCTGCTCTGGCTTTCCAGTTAGAGCTGAACCGGATGAGAAATTTTGACCTCACTGCCATTCCATGTGCTAATCACAAGATGCACCTGTATCTCGGGGCAGCCAAGGTGGAAGTGGGCACAGAAGTGACAGACTACAGGTTCTTTGTTCGTGCAATCATCAGGCATTCTGATCTGGTCACCAAGGAAGCTTCTTTTGAATATCTGCAAAATGAAGGGGAGCGGCTACTCCTGGAAGCCATGGATGAGTTGGAAGTTGCTTTTAACAATACAAATGTCCGCACTGACTGTAACCACATCTTCCTCAACTTTGTGCCCACGGTTATCATGGACCCATCAAAGATTGAGGAATCCGTGCGGAGCATGGTAATGCGGTATGGAAGTCGCCTGTGGAAATTGCGCGTCCTCCAGGCAGAACTGAAAATCAACATTCGCCTGACGCCAACTGGAAAAGCAATTCCCATCCGCCTCTTCCTGACAAACGAGTCTGGCTATTACTTGGATATCAGCCTATACAAGGAAGTGACTGACTCCAGGACAGCACAGATCATGTTTCAGGCATATGGAGACAAACAGGGACCACTGCATGGAATGTTAATCAATACTCCATATGTGACCAAAGACCTGCTGCAATCAAAGAGGTTCCAGGCACAATCCTTAGGGACAACATACATATATGATATCCCAGAGATGTTTCGGCAGTCCCTGATCAAACTCTGGGAGTCTATGTCCACTCAAGCATTTCTTCCATCTCCCCCTCTGCCTTCTGACATGCTGACTTACACTGAACTGGTACTGGATGATCAAGGTCAGCTGGTCCACATGAACAGGCTTCCAGGAGGAAATGAGATTGGCATGGTAGCTTGGAAAATGACCTTTAAAAGTCCTGAATATCCAGAAGGCCGAGATATCATTGTTATTGGCAATGACATCACATACCGAATTGGGTCCTTTGGGCCTCAAGAGGATTTGTTATTTCTCAGAGCTTCCGAACTTGCTAGGGCAGAAGGTATTCCACGCATCTATGTATCAGCCAACAGTGGAGCAAGAATCGGACTGGCAGAAGAAATTCGCCATATGTTTCATGTGGCCTGGGTAGATCCTGAGGATCCTTACAAGG