Transcript asmbl_29272

Sequence
Transcript Sequence for observation asmbl_29272 of TGE0000808:
GTCTCTGTGGCGGGATGCAGGGAATAGGGGGGTAATCCGAGGTACCGGCGCGCGCCCTCCGCCCTCATAGCCATGCCTCGCAAAATTGAGGAGATCAAGGACTTCCTGCTCACGGCCAGACGAAAAGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGATAATGTGAAGTTTAAAGTTCGGTGCAGCAGATACCTTTACACCTTGGTCATCACAGACAAAGAGAAGGCCGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAGCTGAAATGAACCAGACATGCTGATCTGAACTGCATTAAAATTTTTAAAAATCTT