Transcript asmbl_12224

Sequence
Transcript Sequence for observation asmbl_12224 of TGE0059540:
GGTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCGCCATGATGGGCCATCGTCCAGTGCTCGTGCTCAGCCAGAACACAAAGCGTGAATCCGGAAGAAAAGTTCAATCTGGAAACATCAATGCTGCCAAGACTATTGCAGATATCATCCGAACATGTTTGGGACCCAAGTCCATGATGAAGATGCTTTTGGACCCAATGGGAGGCATTGTGATGACCAATGATGGCAATGCCATTCTTCGAGAGATTCAAGTCCAGCATCCAGCGGCCAAGTCCATGATCGAAATTAGCCGGACCCAGGATGAAGAGGTTGGAGATGGGACCACATCAGTAATTATTCTTGCAGGGGAAATGCTGTCTGTAGCTGAGCACTTCCTGGAGCAGCAGATGCACCCAACAGTGGTGATCAGTGCTTACCGCAAGGCATTGGATGATATGATCAGCACCCTAAAGAAAATAAGTATCCCAGTCGACATCAGTGACAGTGATATGATGCTGAACATCATCAACAGCTCTATTACTACCAAAGCCATCAGTCGGTGGTCATCTTTGGCTTGCAACATTGCCCTGGATGCTGTCAAGATGGTACAGTTTGAGGAGAATGGTCGGAAAGAGATTGACATAAAAAAATATGCAAGAGTGGAAAAGATACCTGGAGGCATCATTGAAGACTCCTGTGTCTTGCGTGGAGTCATGATTAACAAGGATGTGACCCATCCACGTATGCGGCGCTATATCAAGAACCCTCGCATTGTGCTGCTGGATTCTTCTCTGGAATACAAGAAAGGAGAAAGCCAGACTGACATTGAGATTACACGAGAGGAGGACTTCACCCGAATTCTCCAGATGGAGGAAGAGTACATCCAGCAGCTCTGTGAGGACATTATCCAACTGAAGCCCGATGTGGTCATCACTGAAAAGGGCATCTCAGATTTAGCTCAGCACTACCTTATGCGGGCCAATATCACAGCCATCCGCAGAGTCCGGAAGACAGACAATAATCGCATTGCTAGAGCCTGTGGGGCCCGGATAGTCAGCCGACCAGAGGAACTGAGAGAAGATGATGTTGGAACAGGAGCAGGCCTGTTGGAAATCAAGAAAATTGGAGATGAATACTTTACTTTCATCACTGACTGCAAAGACCCCAAGGCCTGCACCATTCTCCTCCGGGGGGCTAGCAAAGAGATTCTCTCGGAAGTAGAACGCAACCTCCAGGATGCCATGCAAGTGTGTCGCAATGTTCTCCTGGACCCTCAGCTGGTGCCAGGGGGTGGGGCCTCCGAGATGGCTGTGGCCCATGCCTTGACAGAAAAATCCAAGGCCATGACTGGTGTGGAACAATGGCCATACAGGGCTGTTGCCCAGGCCCTAGAGGTCATTCCTCGTACCCTGATCCAGAACTGTGGGGCCAGCACCATCCGTCTACTTACCTCCCTTCGGGCCAAGCACACCCAGGAGAACTGTGAGACCTGGGGTGTAAATGGTGAGACGGGTACTTTGGTGGACATGAAGGAACTGGGCATATGGGAGCCATTGGCTGTGAAGCTGCAGACTTATAAGACAGCAGTGGAGACGGCAGTTCTGCTACTGCGAATTGATGACATCGTTTCAGGCCACAAAAAGAAAGGCGATGACCAGAGCCGGCAAGGCGGGGCTCCTGATGCTGGCCAGGAGTGAGTGCTAGGCAAGGCTACTTCAATGCACAGAACCAGCAGAGTCTCCCCTTTTCCTGAGCCAGAGTGCCAGGAACACTGTGGACGTCTTTGTTCAGAAGGGATCAGGTTGGGGGGCAGCCCCCAGTCCCTTTCTGTCCCAGCTCAGTTTTCCAAAAGACACTGACATGTAATTCTTCTCTATTGTAAGGTTTCCATTTAGTTTGCTTCCGATGATTAAATCTAAGTCATTTGAGA