Transcript asmbl_26057

Sequence
Transcript Sequence for observation asmbl_26057 of TGE0000940:
GGAGACTGCGCCGACATGGAGCTGTTCCTCGCGGGCCGCCGGGTGCTGGTCACCGGGGCAGGCAAAGGTATAGGGCGCGGCACGGTCCAGGCGCTGCACGCGACGGGCGCGCGGGTGGTGGCTGTGAGCCGGACTCAGGCGGATCTTGACAGCCTTGTCCGCGAGTGCCCGGGGATAGAACCCGTGTGCGTGGACCTGGGTGACTGGGAGGCCACCGAGCGGGCGCTGGGCAGCGTGGGCCCCGTGGACCTGCTGGTGAACAACGCCGCTGTCGCCCTGCTGCAGCCCTTCCTGGAGGTCACCAAGGAGGCCTTTGACAGATCCTTTGAGGTGAACCTGCGTGCGGTCATCCAGGTGTCGCAGATTGTGGCCAGGGGCTTAATAGCCCGGGGAGTCCCAGGGGCCATCGTGAATGTCTCCAGCCAGTGCTCCCAGCGGGCAGTAACTAACCATAGCGTCTACTGTGAGTGCCCCAGCTGTGCCCTCAGCCCCACCCCAGCCCCAGCCTCGCCCTCATCACCGACCCCAGCCCCAG