Transcript asmbl_104559

Sequence
Transcript Sequence for observation asmbl_104559 of TGE0001771:
CGTCAGTCAGTCTGACGGTCAGTGGATCGGTGGGTTTATCTCAAGGCCTGAGTAGCCGGTAACAAACGAGGGTTCCCGGGATTGGACCGACGCAGCCATGCCTCTGCGACTTGATATCAAAAGAAAGCTAACTGCTAGATCTGATCGAGTTAAGAGTGTGGATCTGCATCCTACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACAGGAGCGGATGACATGCAGATTAGAGTGTTCAATTACAATACTCTGGAGAGAGTTCATATGTTTGAAGCACACTCAGACTACATTCGCTGTATTGCTGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCCTCTTTGGACAGGACTATCAAGGTGTGGCAGTTGGGCTCTTCGTCACCAAACTTCACTTTGGAAGGACATGAGAAAGGCGTGAATTGCATTGATTACTACAGTGGTGGGGACAAGCCATACCTCATTTCAGGTGCAGATGACCGTCTTGTTAAAATATGGGATTATCAGAATAAAACATGTGTGCAGACACTGGAAGGACATGCCCAAAATGTGTCTTGTGCCAGCTTTCATCCTGAGTTGCCAATCATTATCACAGGTTCAGAAGATGGAACAGTACGTATTTGGCATTCAAGCACCTACCGGCTTGAGAGCACACTGAATTATGGAATGGAGAGGGTATGGTGCGTGGCCAGTCTAAGAGGGTCAAACAATGTCGCTTTGGGCTATGATGAAGGGAGCATCATTGTTAAGCTTGGTCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCATTCAGAAGTCCAGCAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGTGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACTATTCAGCACAATCCTAATGGGCGGTTTGTGGTGGTGTGTGGTGATGGGGAGTATATCATCTACACAGCAATGGCATTGAGAAACAAGAGCTTTGGATCTGCTCAGGAGTTTGCATGGGCCCACGATTCTTCAGAGTATGCAATAAGAGAGAGCAACAGCATTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGATTTTGGAGCAGAAAGTATCTACGGCGGCTTCTTATTGGGAGTCAGATCTGTAAATGGCTTAGCCTTCTATGACTGGGACAATACAGAACTCATACGAAGAATTGAAATTCAGCCCAAACATATTTTCTGGTCTGACTCTGGAGAGCTAGTCTGTATTGCTACTGAGGAATCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTCTTGGCTGCACAGGAAACACATGAGGGAGTTACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAGATTCAGGAAATTGTGAAAACAGGGCTTTGGGTAGGCGATTGCTTCATTTACACAAGTTCTGTGAACAGATTAAATTATTATGTTGGAGGAGAAATAGTCACCATTGCCCACTTGGACAGGACGATGTATCTCCTAGGCTACATTCCTAAAGACAACAGGCTTTATCTGGGGGATAAAGAATTGAACATCATTAGCTATTCCCTGCTGGTTTCAGTCCTGGAATACCAGACAGCTGTCATGCGGAGGGACTTTAGCATGGCTGATAAGGTCCTTCCTACCATTCCAAAAGAACAGAGGACCAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAAGCTCTTACAGTATCCACAGATCCTGAGCATCGTTTTGAGCTTGCTCTTCAGCTTGGAGAGTTAAAAATTGCATACCAGTTAGCAGTGGAAGCAGAGTCAGAACAGAAGTGGAAACAACTTGCTGAACTTGCCATTAGTAAATGTCAGTTTGGCCTAGCCCAGGAGTGCCTGCATCATGCACAGGATTATGGGGGCCTGCTGCTTTTGGCCACTGCCTCTGGAAATGCTAATATGGTGAACAAGCTAGCAGAGGGTGCGGAGAGAGATGGCAAAAATAATGTGGCATTCATGAGCTACTTTTTACAGGGCAAGGTTGATGCCTGCCTAGAGCTCTTAATTAGAACTGGACGGCTGCCAGAAGCTGCCTTCTTGGCCCGAACTTACTTACCCAGTCAGGTTTCAAGGGTAGTGAAACTCTGGAGAGAGAATCTCTCAAAAGTCAATCAGAAAGCAGCAGAATCCCTTGCTGACCCAACAGAGTATGAAAACCTGTTCCCTGGATTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGGAAACACATGCTGATCTGTGGCCAGCCAAACAATACCCACTTGTCACGCCAAATGAAGAGAGAAATGTCATGGAAGAGGGAAAAGACTTTCAGCCCTCAAGATCTACAGCTCAACAGGAACTTGATGGGAAACCTGCTTCTCCTACTCCGGTTATTGTGGCCTCCCACACAGCCAACAAAGAAGAAAAGAGTTTACTCGAACTAGAAGTAGATTTGGATAATTTGGAATTAGAAGATATTGACACAACAGATATCAATCTGGATGAAGATATTTTGGATGATTGACTGTAATGCTTTCCATTTACCTGACTAAACAGATCATTATTATATATAGGTATTGATTGCTACCCTGACCACAGTGCTTTGGACTATGAGAAACTTCTTAGATTTTTATATGTAAATGCTGTGGACCACTGGGAGCACAATGCCCACATCATCTTAAGAAGAGTTTATGTGCAGCATTTAAATCACTGTGTTTTCCTTGTTAACTAAAACAGACATGGGCTTTGATTTTTTTCATACTATTAGACCATATCTCATAAAACCTTTTGAATTAATGAAGGTACTTGTTTCCTTTCTCAATAATGAAAATAGGCTTCTAGTTTTAGAAGGCTGAGCCGAAACTACACCTTGCCTAGGGATCAGCCCCACTGTCTTTTCTTTGTATAACTAAATCTGCATTTTCAAATGTTGTCAATCACATTTTTCTTAGAGCTGAATATCCAGGCTGTAATTCTCTAAACCCTTTTTCTTGACCTCATTGCATCATTCCACAGGTCTTGCCCCGATTTTGTCTAGCAGCTACCCATTTCTGGAGTCAGGATGTGAAACCTCTGTTCCTCTGACCTCATTAAGCTGGGGGTCTGTCTAAGTTAACGTTTGCCCTATTTGGTAACACAAAAACACACCAGACTTTTTAACCGTACGCTCATCTAACATGATTTGAGAAATTCATAACCAGGCACTCAAATATCCTTGTAGCCTACGAAAAGTGAGTAGGGTAATAATTTTTGCTTTGTAGGGAGAACTACAAATTGATATCTTTTAATCTGGCCATTTTTTAACATTTAGCTCAATATTAACAGAGAAATGTAGTCAGTATTTAGTAAAATAAATGTATTTTTAAAATATTTTTAGGAAGCTGCAGAATGGCGACTGAGTGCTTCTTGATAAGTCTGCAGTGTTAGTTCTATATAGGCTCCCTTCTGTGCTTCTGTTTTTGCAAAGACCTGTTTAAATTAAAAAGAAAATTTTAAAACAATAGGACATATGCTATTTATAAAGTTTTTCAGTTTTAAGACATCATTAGCATTTCTGTAGTAGCAAAGAGTCCTACTTAAAAAGGGCTTTCAGATTTCACAATTTTTCCCCCGATTATACAATAATTAATAAACACACATGGACAGAAAAACAATACCCAACACATTTCAAGCAATACTAATTCTAAACACCAGAAGTATCCAATTAAGACCCTGACATTGTATTAATATTAATACTTCCTTCGAGATCAAAACAAAAACCATTAGGTTAGAGAGAAATCTGGAGGCTAAGAGTTACCAAACTAACTTTTGACTTTAAAGAATATTTTCTCCAAAAACATTGCGCTTTATCAGGTTCATAAAGAAAATCAGTACTGTAGTTTCTCTCTACTCTTCCTAGGATGTCATCACAGGTCATTGTTTCCTTAGCTTTGCAGCATGCAAACAGTATTACTAGGATAGAAGCCAGTTCCACAAAACCATGTATATTCTGAGCATTAGAAGAGATGAAATTAATTATACAATCTCCTCCCCTTCCCTTCCTGAAAATATCATCTCAACTCTCAGCACTTACAGATAAATGTACATAAGCCCATGGTTTTGAGAGGTATGCAGCTCCAAAATGACAATACAGCTAAGGCTTGATGATATACAAGCATCACACTCTCCACTTCTTGACACATGCCCATTTCCCCCGATGTGATGTGACCACACAAAGACAGGAAGCTGCTCTGGGGGACATGTGCTACTTAGTCCTCTACCCTGTCCTGTTGGTGGCTTGAACACCTCAGATGCAGCTCAGCCCTTCCAGTGCTCCAAAGAACAAAGGGGCTGCTCCCTGCACTGTCAGAACTTCTCTGGACTCCAGCTGCTAGCACCACATCACTCAACCTACTTTACTGCACTTTACCCCCCTCCCCTGTCTGTTTCTATTGTCCAGGCTGAAGAAATATGGGGACAAATCATACTGATGTTTTCAAGACCACAGATGTCCCATATTCACAAATCTGTTTAGTTACCATTAATTATGACCCAATTCTGAATTTTTCCCAGCTCAATTACCACCACAAAACAACCAATATGAAAAAAAAACTTTACCTTGATTAAATTTATTCCCTCAGCAGCCTGATCCTTGGCCCCTTGAGCCGACTGGCCATCTGGATGGAGCACGTGATACAGCTGGACCAAGTTGGTTGCATCATCGATTCTGAGAATGAAAGGGTTTAATGTTATCTAGGGGTTTTCTTCATTTGATTCACAGTCCTATAAAAGTGTGTGCCAACTTCAAACTAAATTACATTTCAGACTTTCCTCAGGCTGGAGGGATTGGGGAAGGACCTTCAGTTTTACAGTTTCAAAAGCATTTTCAGGAAAATTGACTAATTTAGGCCTCACACCAACTCCGTGAGGCAGCTAGGGCAGGAGTCACTGCAGGAAGTGTCCAATTTATGAAAGTGAATATATTCCAAATGTGGCTATATTCTTTTTGGAAAAAGAGCACCATTTCTCACAGAAACAGCATTCCTAATGGTAGACAATTTCCAGGCCAGCTTACTTCACCAGCATGTAATAGTCTAATCCAACTCAGAGGACAGAAACACAGCTTCATCCCACATAAGCAGGAGGGTGGTGGTCACAGGGATCTCAAAGTCACTTGCCTCTAAGTGACATTTGCTAACAGACAAATGCCTCTACAAGAGGCCCCCTAAGATTCCAAGGAAAGGATTCACAGGAACGCATTAGTAAAATAGCATCCTAGTGAAGCAAATTTGAAATTATACACACACATCAGACAAAAAGGAAAATCGGGTTCTACATCAGCAATCTGTCTTAACTTCAGCATCACACAACTACCTATGAAGAAGACAGAACAAGAATTCAGTTCTTCTGGTCTGTACTTCTCAGAAATGTATAAACAATTTTTATCAACATTAAAACTGTCCTAGCAAAACCAAACAATCACTATCTTTTCACACAGCTGACACTTTCCCACCATTTGCCATCTCATCGCTGGAGGGCACAGAAAAACGACACTCAAAATGCTTGTGCTTTTGAGGCTCTGCTATATACACTAAGTGAACTACTGGCTTCCAGTTGGGAATGGAGGGCTGAGGACACCCTAATTCAGTGCTTCCGCAGCTAGCACTCTTCAGCCTTCCCTGCGTTCCCCTTACCTGAGCTGGGGGATGAAGAGCAGGGTGACAGTGGGAGTAAGTACAGAATTCCTCAAGCCTTGGTAGCCTTAGAGAAATGCTCTGGGCTTATACTGAGGCTCATCTACCCTAAAGGCCATCTCTCAGGAAAACAGAGCTGTTGTATCATAAAGCTTTTCAGGGGGAAAAAAATAAAAAATGTTCATCACAAATCTATTGTGCTTGTTATAATCTAACAAAGTCCACTAAATGTAGTAACGAAATGTCTCCCCAATAAAAAATTAAGATTCCCTTTGGAGCTTAGGCATGTGGCCTTATAAAGAGCTTAACTGGACTGCTACCTGTTGGTATGTTCAGGGCTTCATTAGGTTCATGCTTAAGTATAATGCCTGTGCCTCACAGAACAATTTAAATTTAGCTTAACACCCCACCCATACTTAAAGAGCAAATAAATTATATTTCGAAAAGATTTTAAAATAATCTCAATATAAAAACCAACAGTGGGAACTGAGTCTGGAATAAATGTGTGCAGAATCCTAATTCTTTTCTGAGCTCCACTCAGTGAGGATATGCACCCTCTACTGTCCAGCCTGTGGTTTGCAGTAAGCTCACTCTTCTGTTCAGAATGACCACAGGAGGGCCTTTACCTAGGAATAGCAGGAAAAGCTAAGTAAGTACTCAAACTTCCCTCCCAGTAAGCATGAATTGCTTCAGATGTAAAGCTTACATGTGATGAGTAATACTATAATATCATACATTAATATATCCT