Transcript asmbl_100342

Sequence
Transcript Sequence for observation asmbl_100342 of TGE0001625:
TTTCCGCTGCTGCTTCTGTGAGTTTTTCCGGTGCACGCGAGTGCTTCTGAAACGTCAGCTGCGCTCCCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAAACCTGTGGCCTCTGCCACGTGCTCCCTGCCAGCTTCCCCCCTGAGGTTGTGTATCATATTATCTGTGTTAGCATGTAGTATTTTCAGCTACTCTCTATTGTTATAAAATGTAGTACTAAATCTGGTTTCTGGATTTTTGTGTTGTTTTTGTTCTGTTTTACAGGGTTGCTATCCCCCTTCCTTTCCTCCCTCCCTCTGCCATCCTTCATCCTTTTATCCTCCCTTTTTGGAACAAGTGTTCAGAGCAGACAGAAGCAGGGTGGTGGCACCGTTGAAAGGCAGAAAGAGCCAGGAGAAAGCTGATGGAGCCAGGACAGAGATCTGGTTCCAGCTTTCAGCCACTAGCTTCCTGTTGTGTGCGGGGTGTGGTGGAATTAAACAGCATTCATTGTGTGTCCCTGTGCCTGGCACACAGAATCATTCATACGTGTTCAAGTGATCAAGGGGTTTCATTTGCTCTTGGGGGATTAGGTATCATTTGGGGAGGAAGCATGTGTTCTGTGAGGTTGTTCGGCTATGTCCAAGTGTCGTTTACTAATGTACCCCTGCTGTTTGCTTTTGGTAATGTGATGTTGATGTTCTCCCCCTACCCACAACCATGCCCTTGAGGGTAGCAGGGCAGCAGCATACCAAAGAGATGTGCTGCAGGACTCCGGAGGCAGCCTGGGTGGGTGAGCCATGGGGCAGTTGACCTGGGTCTTGAAAGAGTCGGGAGTGACAAGCTCAGAGAGCATGAACTGATGCTGGCATGAAGGATTCCAGGAAGATCATGGAGACCTGGCTGGTAGCTGTAACAGAGATGGTGGAGTCCAAGGAAACAGCCTGTCTCTGGTGAATGGGACTTTCTTTGGTGGACACTTGGCACCAGCTCTGAGAGCCCTTCCCCTGTGTCCTGCCACCATGTGGGTCAGATGTACTCTCTGTCACATGAGGAGAGTGCTAGTTCATGTGTTCTCCATTCTTGTGAGCATCCTAATAAATCTGTTCCATTTTGATGACAG