Transcript asmbl_75344

Sequence
Transcript Sequence for observation asmbl_75344 of TGE0001383:
GGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCCTATCTCATTCCTTTCTTTCGATTACCCGTGGCGCGGAGAGTCAGGGCGGCGGCTGCGGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGTCTTGCCTTCTTCTTAGGTTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGACGGGAAAACAATCAAGCTTCAAATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAATGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAATTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCGAAGGAATTTGCTGATTCCCTTGGAATTCCGTTTTTGGAAACCAGTGCTAAGAATGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCCGGAGCAACAGCTGGTGGTGCTGAGAAGTCCAATGTTAAAATTCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCATCCTTTTCTCACAGCAATGAATTTGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAAGCAGTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTGATTCTTATGGTTAAAGGGAAATAGAGCCTTGCATTATATTCAACACAGCCATTTGTGTGTGCACAATGCAAACTAAGGTATTCTAGACCTATCTTAGAGCAGCATCCAGTATTTGCTTTCTAGATAATATGCCCAATAACATGACCTAGAGGGGCTTCTGTGCTGTGTAGGGATTTAACCAACTTCAGTGGTTCAGGGAGCTCAAACTATATGTAAAACAAGTTTAGAATGTATGCTATCTAGCCCGTTATCTCTGATCCTTCTCTAAAACCATTTGAAATAGCTTCATTGATCAACATTTCATAAATGCATCTGTGGTAGAGGTAGAAAGCAGCACCTTTCCTAATTGGCAAATGATCAGACTAATGTGTGCTAATGTTTTTCTTCCATGCTTTCAGTCAGATTCAACTATTTTATCCTCCACAGTTGCTTAACTTGGTGTTGGAGGAGGGTTTAAGCATTAAGATAGGAAGCAGGAAATTTGATTGCTCTAAATTTAGAAATTATATCCCTAAAAATTAAAACATGAATACTGGGTGGTAATGATAATTGAGGCAAATGTATTTATTTTGGTGACATTTTGCATATATGAAGATTTTCTGAAATAGGACCTTCAAGATCCTAGGGGGTTTTGTTTGGTTTTTAATTGTGAGGAATAAAAAATCTTCTGCCCACACTGGCATTTTAAGGTGACTGAGGTCAAACGTTGTTTCCTTAGGTTGAAATAGCAGCCAAAACATTCTTCACGCAGGGGCTTGGGATATGGCTGCTGGCAACACATTTTGTTGTGGGCTCCTTAATTTAATGATAAAATTTAAGCTAAACACAAGCCAAAAATGAATAGGTTTTTTTAATTTTTATTTTTCACTAAACAGGCAATTGAAATACATGGTACAAAAATAAGTGGTAAGATAATTGTAAAATGAAATGGACAGAATATTCAATTTTCCATCTATGAAAATTTCACAATAAAAATCATAGTTTACTTTGTATTATAGGCGTGCTTGGTGGATCTATTCATCCTCACATAAGGCAACTGACAAATTCCTGAAGTT