Transcript asmbl_75094

Sequence
Transcript Sequence for observation asmbl_75094 of TGE0056843:
ATACGACCTTTCGGCCATGTTAGCCAGGAGCGAGGGGCAGGGCTAAGGGGCCGGCGGCCACTCGGCATCTGGGTTTTAGTCAGGCAGTGCTCCAGGCGCCTGGCTGCCAGGCTACGGGAGAAAAGTCCTCCGCTCGGCCGCACCCGTTAGAGGCGCTCTCCACTGCTGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTCAGCCGCTTTTCTGCCTTCAGGATCCTCCGCTCCCGAGGTTATATATGCCGCAATTTTACAGGGTCTTCTGCTTTGCTGACCAGAACCCATATTAACTATGGAGTCAAAGGGGATGTGGCAGTTGTTCGAATTAACTCTCCCAATTCAAAGGTAAATACACTGAGTAAAGAGCTACATTCAGAGTTCTCAGAAGTTATGAATGAAATCTGGGCTAGTGATCAAATCAGAAGTGCCGTCCTTATCTCATCAAAGCCAGGCTGCTTTATTGCAGGTGCTGATATCAACATGTTAGCCGCTTGCAAGACCCTTCAAGAAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACTTGAAAAGTCCACAAAGCCTATTGTGGCTGCCATCAATGGATCCTGCCTGGGAGGAGGACTTGAGGTTGCCATTTCATGCCAATACAGAATAGCAACAAAAGACAGAAAAACAGTATTAGGTACCCCTGAAGTTTTGCTGGGGGCCTTACCAGGAGCAGGAGGCACACAAAGGCTGCCCAAAATGGTGGGTGTGCCTGCTGCTTTGGACATGATGCTGACTGGTAGAAGCATTCGTGCAGACAGGGCAAAGAAAATGGGACTGGTTGACCAACTGGTGGAACCCCTGGGACCAGGACTAAAACCTCCAGAGGAACGGACAATAGAATACCTAGAAGAAGTTGCAATTACTTTTGCCAAAGGACTAGCTGATAAGAAGATCTCTCCAAAGAGAGACAAGGGATTGGTGGAAAAATTGACAGCGTATGCCATGACTATTCCATTTGTCAGGCAACAGGTTTACAAAAAAGTGGAAGAAAAAGTGCGAAAGCAGACTAAAGGCCTTTATCCTGCACCTCTGAAAATAATTGATGTGGTAAAGACTGGAATTGAGCAAGGGAGTGATGCCGGTTATCTCTGTGAATCTCAGAAATTTGGAGAGCTTGTAATGACCAAAGAATCAAAGGCCTTGATGGGACTCTACCATGGTCAGGTCCTGTGCAAGAAGAATAAATTTGGAGCTCCACAGAAGGATGTTAAGCATCTGGCTATTCTTGGTGCAGGGCTGATGGGAGCAGGCATCGCCCAAGTCTCCGTGGATAAGGGGCTAAAGACTATACTTAAAGATGCCACCCTCACTGCGCTAGACCGAGGACAGCAACAAGTGTTCAAAGGATTGAATGACAAAGTGAAGAAGAAAGCTCTAACATCATTTGAAAGGGATTCCATCTTCAGCAACTTGACTGGGCAGCTTGATTACCAAGGTTTTGAAAAGGCCGACATGGTGATTGAAGCTGTGTTTGAGGACCTTAGTCTTAAGCACAGAGTGCTAAAGGAAGTAGAAGCGGTGATTCCAGATCACTGTATCTTTGCCAGTAACACATCTGCTCTCCCAATCAGTGAAATCGCTGCTGTCAGCAAAAGACCTGAGAAGGTGATTGGCATGCACTACTTCTCTCCCGTGGACAAGATGCAGCTGCTGGAGATTATCACGACCGAGAAAACTTCCAAAGACACCAGTGCTTCAGCTGTAGCAGTTGGTCTCAAGCAGGGGAAGGTCATCATTGTGGTTAAGGATGGACCTGGCTTCTATACTACCAGGTGTCTTGCGCCCATGATGTCTGAAGTCATCCGAATCCTCCAGGAAGGAGTTGACCCGAAGAAGCTGGATTCCCTGACCACAAGCTTTGGCTTTCCTGTGGGTGCCGCCACACTGGTGGATGAAGTTGGTGTGGATGTAGCGAAACATGTGGCGGAAGATCTGGGCAAAGTCTTTGGGGAGCGGTTTGGAGGTGGAAACCCAGAACTGCTGACACAGATGGTGTCCAAGGGCTTCCTAGGTCGTAAATCTGGGAAGGGCTTTTACATCTATCAGGAGGGTGTGAAGAGGAAGGATTTGAATTCTGACATGGATAGTATTTTAGCGAGTCTGAAGCTGCCTCCTAAGTCTGAAGTCTCATCAGACGAAGACATCCAGTTCCGCCTGGTGACAAGATTTGTGAATGAGGCAGTCATGTGCCTGCAAGAGGGGATCTTGGCCACACCTGCAGAGGGAGACATCGGAGCCGTCTTTGGGCTTGGCTTCCCGCCTTGTCTGGGAGGGCCTTTCCGCTTTGTGGATCTGTATGGCGCCCAGAAGATAGTGGACCGGCTCAAGAAATATGAAGCTGCCTATGGAAAACAGTTCACCCCATGCCAGCTGCTAGCTGACCATGCTAACAGCCCTAACAAGAAGTTCTACCAGTGAGCAGGCCTCATGCCTCGCTCAGTCAGTGCACTAACCCCAGCTGCCGGCAGTGCTGGTTCTCCAACAGAGTGGTGTCTAGATTTATCAGAGTAACGAGAAGACAAACTCCGGCACTGGGTTTGCTCCCTGATTAAAGTGCCTTCAGCCAAGACCATCTCTCCCTCCTGGTGAAGTGTGACTTCGAATTAGTTTGCACTTCCTGTTGGAAGGTAGAGCCCACTGCTCATTGTATAAGCCCCGAGGCCTAGAGTGGCAGCCAAGAGCCATCTGAAGCCACCTCTCTGCCTGTTCCTCCCAAGAGGCCAGGGTGGCCAGGGGTGGTGAGGGCAGTTCTGCACCCAGCCAAACACATAACAATAAAAACCAAACTCTGTGTCAGCATCTTTGCCCTTCTGGTTTAAACGCCTCCTTCAAAAAGCAATCTGGAAGAAAGCCCTGTGCTTTGGGGGAGTAAGAATGTGTGTGCAGAATTCTAGGCAGCACCTTAGGGAGGGACTGGGATGAGAGAAAGTGGGACCTGGTGGGCTCAACCACACACACCTGTCTGTGCAGATGCTTTGCCCAGGCTTCTCACCACGGTGTACCGGGATATTAAACCTCTTTCCCCAG