Transcript asmbl_44217

Sequence
Transcript Sequence for observation asmbl_44217 of TGE0059861:
CTGGCTGAGGCGGCGCCAGTTGGCCGGGCACGGGGCTGCTGTAAGGCCGAGGTTGCGGCGGAAGCGGAGACCATGTTCCGAGCGGCGGCTCCGGGGCAGCTCCGGCGGGCGGCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAAGATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAGAACCTTTTGCCCAGAGTAGCAGCCAAACTTGAGGTTGCCCCGATTTCTGACATCATTGCAATCAAGTCACCTGACACATTTGTGAGAACTATTTATGCAGGAAATGCTCTATGTACAGTGAAGTGTGATGAGAAAGTGAAAGTGTTTTCTGTCCGTGGAACATCCTTTGATGCTGCAGCAACAAGTGGCGGTAGTGCCAGTTCAGAAAAGGCATCAAGTACTTCACCAGTGGAAATATCAGAGTGGCTTGACCAGAAATTAACAAAAAGTGATCGACCAGAGCTAACAGGTGCCAAAGTGGTGGTATCTGGTGGTCGAGGCTTGAAGAGTGGAGAGAACTTTAAGTTGTTATATGACTTGGCAGATCAACTACATGCTGCAGTTGGTGCTTCCCGTGCTGCTGTTGATGCTGGCTTTGTTCCCAATGACATGCAAGTTGGACAGACGGGAAAAATAGTAGCACCAGAACTTTATATTGCTGTTGGAATATCTGGAGCCATCCAACATTTAGCTGGGATGAAAGACAGCAAGACAATTGTGGCAATTAATAAAGACCCAGAAGCTCCAATTTTCCAAGTGGCAGATTATGGAATAGTTGCAGATTTATTTAAGGTAGTTCCTGAAATGACTGAGATATTGAAGAAAAAATGAATCAGGATCATGCCTTAAAAAGAAAACTTTTGTTAAAGTATTCCACTGAAATCACAGATATTTGTGGGTATTATAACAATCATTGGAAAGCATGGAGAGCTACATTTCATAATTTGAGGGAAAATTTCTAACAGATGCCAGAATGCTTGTTTATGGGATTGCTGTGTTTCCTTTTAATTATTTGTGGTTCCAAACAATTATTGTTTGAACTTTTTAAATTCTGTACTAAAATCTATAATAAAGCTTTTCCACAGCTTTAAAACTATCAGAAATATGCCTAGCCTCTAGAGAAAATTGAAGAAAAGGAGTAAAAATTTTGTTTATTTATTTATTTTTTT