Transcript asmbl_44104

Sequence
Transcript Sequence for observation asmbl_44104 of TGE0056539:
CAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTACTCCGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCTGTATTCAAGGCTCCTATTCGACCAGATATTGTGAACTTTGTTCACACCAACTTGCGCAAAAACAACAGACAGCCCTATGCTGTCAGTGAATTAGCAGGTCATCAGACTAGTGCTGAGTCTTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTCGAGGTGGTGGGACTCACCGCTCTGGCCAGGGTGCTTTTGGAAACATGTGTCGTGGAGGCCGAATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCATCGTAGAGTGAACACAACCCAAAAACGATACGCCATCTGTTCTGCCCTGGCTGCCTCAGCCCTACCAGCACTGGTCATGTCTAAAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTAGTTGAAGATAAAGTTGAAGGCTACAAGAAGACCAAGGAAGCTGTTTTGCTCCTTAAGAAACTTAAAGCCTGGAATGATATCAAAAAGGTCTATGCCTCTCAGCGAATGAGAGCTGGCAAAGGCAAAATGAGAAACCGTCGCCGTATCCAGCGCAGGGGCCCGTGCATCATCTATAATGAGGATAATGGTATCATCAAGGCCTTCAGAAACATCCCTGGAATTACTCTGCTTAATGTAAGCAAGCTGAACATTTTGAAGCTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCTTTCCGGAAGTTAGATGAATTGTACGGCACTTGGCGTAAAGCCGCTTCCCTCAAGAGTAACTACAATCTTCCCATGCACAAGATGATTAATACAGATCTTAGCAGAATCTTGAAAAGCCCAGAGATCCAAAGAGCCCTTCGAGCACCACGCAAGAAGATCCATCGCAGAGTCCTAAAGAAGAACCCACTGAAAAACTTGAGAATCATGTTGAAGCTAAACCCATATGCAAAGACCATGCGCCGGAACACCATTCTTCGCCAGGCCAGGAATCACAAGCTCCGGGTGGATAAGGCAGCTGCTGCAGCAGCGGCACTACAAGCCAAATCAGATGAGAAGGCGGCGGTTGCAGGCAAGAAGCCTGTGGTAGGTAAGAAAGGAAAGAAGGCTGCTGTTGGTGTTAAGAAGCAGAAGAAGCCTCTGGTGGGAAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAGTGAGAAACATGACTTGGTGTGCTCTGTAAAGCTTGGTTAGAATTTTTTTAAAGTGACATTTTGTTGGCCATAATTTAGACTGTTACATTTTATATAGTGTGGTATAAAATGGGGCATGGATTTATACTAAGTCCATGGAGTTCAGTGGAAGGGGAATGATTTAAAAAAAGTTGTGGTTTTCTAAATAATGTGGCTTGAAAAATAGGTGTAACAGGACTTGGTCAGAAACGCAGAGGCTGTTCAAGTTTAGCTCCCCACCAGATGGAAAATAGGTTAAATTCTGTAAAGATTTAACTTTAACCACAAGAGGGCACAACTGGAGAGCACAATTTTTTTGGTACTGCAGTAAAATTGATTACCTCTTGAGAAGTGTTCTTTTTAACCAGCTATAACAATAGAGTTGAGTATTTTCACCCATGGTTTGAAAAAGTGCCAGAAGGCCACACTGGCCCACATCTGTAATCCCAACACTTTG