Transcript asmbl_44042

Sequence
Transcript Sequence for observation asmbl_44042 of TGE0057029:
CTTCCTGTGGGCGGGAGAGGGCGGCCGGGAGCCCAATGAGGGAGCAATAACGTGGCAACCACCCACGAGCCCGCGTCGGTGCCCGCCCCGCAGGGGGACCTACTATCCGGCGCCGAGCCGGAGGGGGGAAACGGCGCCCGCCGCCCGCCCGGAGCCCGCGAGCAACCCCAGTCCCCCCCACCCGCGCGTGGCGGCGCCGGCTCCCTAGCCACCGCGGCCCCACCCTCTTCCGGCCTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAGGGCACAGGGACATCTTTCTTTGAGTGACCGTCTGTGCAGGCCCTGTAGTCCGCC