Transcript asmbl_35519

Sequence
Transcript Sequence for observation asmbl_35519 of TGE0056198:
GAGACCCTAGCTCTGCTCTCGGTCCGCTCGCTGTCCGCTAGCCCGCTGCGATGTTGCGCGCTGCCGCCCGCTTCGGGCCCCGCCTGGGCCGCCGCCTCTTGTCAGCCGCCGCCACCCAGGCCGTGCCTGCCCCCAACCAGCAGCCCGAGGTCTTCTGCAACCAGATTTTCATAAACAATGAATGGCACGATGCCGTCAGCAGGAAAACATTCCCCACCGTCAATCCGTCCACTGGAGAGGTCATCTGTCAGGTAGCTGAAGGGGACAAGGAAGATGTGGACAAGGCAGTGAAGGCCGCCCGGGCCGCCTTCCAGCTGGGCTCACCTTGGCGCCGCATGGACGCATCACACAGGGGCCGGCTGCTGAACCGCCTGGCCGATCTGATCGAGCGGGACCGGACCTACCTGGCGGCCTTGGAGACCCTGGACAATGGCAAGCCCTATGTCATCTCCTACCTGGTGGATTTGGACATGGTCCTCAAATGTCTCCGGTATTATGCCGGCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACACACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCGTGGAATTTCCCGCTCCTGATGCAAGCATGGAAGCTGGGCCCAGCCTTGGCAACTGGAAACGTGGTTGTGATGAAGGTAGCTGAGCAGACACCCCTCACCGCCCTCTATGTGGCCAACCTGATCAAGGAGGCTGGCTTTCCCCCTGGTGTGGTCAACATTGTGCCTGGATTTGGCCCCACGGCTGGGGCCGCCATTGCCTCCCATGAGGATGTGGACAAAGTGGCATTCACAGGCTCCACTGAGATTGGCCGCGTAATCCAGGTTGCTGCTGGGAGCAGCAACCTCAAGAGAGTGACCTTGGAGCTGGGGGGGAAGAGCCCCAACATCATCATGTCAGATGCCGATATGGATTGGGCCGTGGAACAGGCCCACTTCGCCCTGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTCGTGCAGGAGGACATCTATGATGAGTTTGTGGAGCGGAGCGTTGCCCGGGCCAAGTCTCGGGTGGTCGGGAACCCCTTTGATAGCAAGACCGAGCAGGGGCCGCAGGTGGATGAAACTCAGTTTAAGAAGATCCTCGGCTACATCAACACGGGGAAGCAAGAGGGGGCGAAGCTGCTGTGTGGTGGGGGCATTGCTGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAGTTCAGCAAGATCAGCAACAAAACCAAGAAAAATGATCCTTGCGTGCTGAATATCTGAAAAGAGAAATTTTTCCTACAAAATCTCTTGGGTCAAGAAAGTTCTAGAATTTGAATTGATAAACATGGTGGGTTGGCTGAGGGTAAGAGTATATGAGGAACCTTTTAAACGACAACAATACTGCTAGCTTTCAGGATGATTTTTAAAAAATAGATTCAAATGTGTTATCCTCTCTCTGAAACGCTTCCTATAACTCGAGTTTATAGGGGAAGAAAAAGCTATTGTTTACAATTATATCACCATTAAGGCAACTGCTACACCCTGCTTTGTATTCTGGGCTAAGATTCATTAAAAACTAGCTGCTCTTAACTTACTGGGTAACTCTTTGTCCATCTCAATAACCAAAGGAAGGTGGGCATGGTGGCTCACGCCTGT