Transcript asmbl_35127

Sequence
Transcript Sequence for observation asmbl_35127 of TGE0056195:
CATTACTGCAGGAAAAGGTCCCGGAGAGCTGAGCAGTCAAGATGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGGTAAGAGGTGAACTGCGCTTTCTCAGAGAAAGCAGCCATATGGGGCAGGTCAAGTATAGTGTCTGGGGCTTTCCCTATCCCTGGACTTGGGCTCCAAAAAGAGCCAGGAGGCAAGGTGCAGGGCCCTGCCCAGCCCAGCCCAGGAGTGGGAGGTCAGGGCGGTATAACAGGAAAGGAAGGGGGTAGTATTGTAGAGGGTGGGAAGGAATGAGAAGTGAAATAATGGAATGTCTGTCCCCACTGCCTGACCCCTCACCCCATGTCTTTGTCTTGTCTTCACCATGAATGTCTCTTCCTTCCTGCAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGGTACGGCTCCTCCCAGCCTCTCCTCTAGTTGATCTCCCCAGTGTTTCTTTTTTCCCCAACCTGTGCTCTTTATCCCCTGCCCTTACCCTACTACCATCTGACTTCCTCCTGGCATGTTTCTGCATGGAGCTGACTAGGGAGGGGAGGGATTCCTCAAAGAGGAAGACAACCTGGGGGTACAGTACCTCCTTACCTCTAGAATGGGCCCTGAGGTTTTACTTATGCGGCCCTGGGTGCTGGTGTCTGGGAACTCTCACCAGCCTGTATACCAGTCTTGCTTTAGGGTGACCTTCTGGCCCTGGAGCATGGGTAGCTGGCATAGAGGGGTATGGGTTGCCTGCCCCATTCTGCTGCTATAGCTGAACAGTCCTTTCCCCTTCCCTCGCTGGGCAGCTTGGAGGTACCCTAACCCAAAACTCTGTCCTCTCCTCCCGCCAGTGGCTGACAGTAGCTGTAGGTGTAGTGGAGAACTTTTCTGCCTCTGCTGTGTTCTTGCTGCTTAGGTTTGGGTGGGGGACTAACAGCTGCTGGGAGGGGAGCTAGGGGCATGGAGAACTGGTCAGACTCAAGGTGGCTCCTCTGCAAACTGACCCCAGGGTTGGTTGCTGTGGGCATGTTCCCGCTTATGCTACCTTTGCAGTCTGGTAGTCCCCTGGCCCTTGGCGTACCCCTCCACAGCCCTGTTCCCTGGCTCATCCCACCTTTCCTTTCCACAGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGGTGCAGGGGTTGAGGAAAGCTGGGGGAGGCCCTGTACTAGCCATCTGGGCTTCATTTAAAAACTACTGGCCCCATTCATCCATCTTACACAAGCTACCTCTTGGGAGATTAGGAAAGCCATAGATCCCA