Transcript asmbl_27828

Sequence
Transcript Sequence for observation asmbl_27828 of TGE0057004:
CCGCTAGGGGTGCGGGGTTGGGGAGGAGGCCGCTAGTCTACGCCTGTGGAGCCGATACTCAGCCCTCTGCGACCATGGCTGTGCTGGCGGCACTTCTGCGCAGCGGCGCCCGCAGCCGCAGCCCCCTGCTCCGGAGGCTGGTGCAGGAAATAAGATATGTGGAACGGAGTTATGTATCAAAACCCACTTTGAAGGAAGTGGTCATAGTAAGTGCTACAAGAACACCCATTGGATCTTTTTTAGGCAGCCTTTCCTTGCTGCCAGCCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAAGCTCCTACAAGGCAGGCAGTATTGGGTGCAGGCTTACCTATTTCTACTCCATGTACCACCATAAACAAAGTTTGTGCTTCAGGAATGAAAGCCATCATGATGGCCTCTCAAAGTCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAATGTTCCATATGTAATGAACAGAGGATCAACACCATATGGTGGGGTAAAGCTTGAAGATTTGATTGTAAAAGACGGGCTAACTGATGTCTACAATAAAATTCATATGGGCAGCTGTGCTGAGAATACAGCAAAGAAGCTGAATATTGCACGAAATGAACAGGACGCTTATGCTATTAATTCTTATACCAGAAGTAAAGCAGCATGGGAAGCTGGGAAATTTGGAAATGAAGTTATTCCTGTCACAGTTACAGTAAAAGGTCAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTTAGCAAAGTTCCAAAGCTGAAGACAGTTTTCCAGAAAGAAAATGGCACAGTAACAGCTGCCAATGCCAGTACACTGAATGATGGAGCAGCTGCTCTGGTTCTCATGACGGCAGATGCAGCGAAGAGGCTCAATGTTACACCACTGGCAAGAATAGTAGCATTTGCTGACGCTGCTGTAGAACCTATTGATTTTCCAATTGCTCCTGTATATGCTGCATCTATGGTTCTTAAAGATGTGGGATTGAAAAAAGAAGATATTGCAATGTGGGAAGTAAATGAAGCCTTTAGTCTGGTTGTACTAGCAAACATTAAAATGTTGGAGATTGATCCCCAAAAAGTGAATATCAATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTTGGTCATTTGACTCATGCCTTGAAGCAAGGAGAATACGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCAGAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAGCTTATATTCAGATAAGCTGTTTCATTTTTTATTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAACATTTTGAAATTAAAAATAAATTTCTTCTTCTGCTTTTTTCTTGGTAACCTTGAAA