Transcript asmbl_13523

Sequence
Transcript Sequence for observation asmbl_13523 of TGE0031172:
AGGGCGGGGACAATTGAGAACGCTTCCCGCCGGCGCGCTTTCGGTTTTCAATCTGGTCCGATACTCTTGTATATCAGGGGAAGACGGTGCTCGCCTTGACAGAAGCTGTCTATCGGGCTCCAGCGGTCATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGGGGCGCTAAGCGCCACCGCAAGGTCTTGAGAGACAACATTCAGGGCATCACCAAGCCTGCCATTCGGCGTCTAGCTCGGCGTGGCGGCGTTAAGCGGATCTCTGGCCTCATTTACGAGGAGACCCGCGGTGTGCTGAAGGTGTTCCTGGAGAATGTGATTCGGGACGCAGTCACCTACACCGAGCACGCCAAGCGCAAGACCGTCACAGCCATGGATGTGGTGTACGCGCTCAAGCGCCAGGGGCGCACCCTGTACGGCTTCGGAGGCTAGGCCGCCGCTCCAGCTTTGCACGTTTCGATCCCAAAGGCCCTTTTTAGGGCCGACCACTTGCTCATCTGAGGAGTTGGACACTTGACTGCGTAAAGTGCAACAGTAACGATGTTGGAAGGCTTATGATTTTACTGTGTATGTATTTGGGAGAAGAAATTCTGTCAGCTCCCAAAGGATAAACCAGCAGTTGCTTTATTGGTCTTCAGATGTGGCTGCAAACACTTGAGACTGAACTAAGCTTAAAACACGGTACTTAGCAATCGGGTTGCCAGCAAAGCACTGGATGCAAGCCTTGCCTTCCAGAAGCTTACCAGTCGGGTTGCCAGCAAAGCAGTGGATGCAAGACTTGCCCTCCAGGAGCTTACCATCACAACGAAGAAGACAAATAAATGCATAATATATAGACGACATAAATCCATACTGTACACATTTAAGAATAAACAGTCCAGTAGTAAGAGGCAGTACATATTCAATCTGCTGAG