Transcript asmbl_133906

Sequence
Transcript Sequence for observation asmbl_133906 of TGE0002707:
CGTGACCGGAGGAGGCGGGAGCTCAGGACCGGCGCCTTCTCCTTGCTTCTGGGGGTCGTGGCCTTGCTCCCGCTGTGCGGGAAAAGAATCCAGGCCCTTCCACGCGCGTGTGGGTGCGGGGGCCCCGAAGTGCTCGTGGTTCCCCGCTAGGTCTCCGCTGGGGCAGGAACCGGAATCATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTCGGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCCGAAGATCAGAAACGACTAAAGCAAGCCAAAGAGCTGGACCGAGAGAGGGCTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATGTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGGCTAGGCAGCTGGAAGAGAAAGACCGAGTGCTAAAGAAGCAGGATGCATTCTACAAAGAACAGCTGGCTAGACTGGAGGAGAGGAGCTCAGAGTTCTACAGAGTCACCACTGAACAATATCAGAAAGCTGCTGAAGAGGTGGAAGCAAAGTTCAAGCGATATGAGTCTCATCCAGTCTGTGCTGATCTGCAGGCCAAAATTCTTCAGTGTTACCGTGAGAACACCCACCAGACCCTCAAATGCTCCGCTCTGGCCACCCAGTATATGCACTGTGTCAATCATGCCAAACAGAGCATGCTTGAGAAGGGAGGATAAAAACTTTCAGAATGAGCAAAACACCATCAACGTTAATTCCAGAGATGGAACATTTTTTTTCCTAGTGAGAAAACAACCCATTTGAAGAGAAGACCACTAATGAGAAGACCACTAAAGAGAGACATCAAGAATGGATTCAGCAGAATCATTTCACGTTTTGAACAGCAGCAGTTTGAAGGGCCAAAGCCTTGATCAGGGATCAGTCATTAAAGGACACTCTTGAGTATTAGTAAACCCTCTTATGATGATTAAAAGAGAAGGGCAGCCCTCTCCACCTTTTGGTACTTTCTATTCAACTTGCACTGACCATAAAATGTTTCTCTTCTGAACAAGCCCCATCATTTGGTGAACCTCCACCCTAACAAAGTAGGATGGGGTTGGGGGCTAAATTAATTGGAGTGGGGCGAGGAGAGAGCCAGAAAACATAGATCCGAGGGCAGCAGTGCTGGGTGGAGAGAGCCAGAAAACAGATCTGGAGGCAGCAGTGCTGGATGGAATTGTCTAGGCTGTGGCATGTTGGTTTTGTCTTTCTTTTCTCCTTTGATTATGTAAGAGCTATTTCATTATAACTTATTATGGTGATTATACAGGCAAGAAGACAAAAAGGAGAGAAAATGTACCTCTTCTACTGGAATAATGTTTATGATTACAAGTGAGATAAGGTATTTTTATCAATATGAAGGCAACCTTGGCTGATAAAACCTCTATAGTGAATACTCACATCTTTACTTCACTCACTATCAATAATAAATATATTTTCTGACAAAGACTGGCATTGTAGCTCCTCACACATTCCTTTGGCTGGGTTAGATGTCTATGCTTACGGGAATTGAGCTG