Transcript asmbl_133212

Sequence
Transcript Sequence for observation asmbl_133212 of TGE0059816:
GTTCTAGAAAAGCGGCGGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCAGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGTCCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAGAGAAAAGGAACAGTTCCGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCTGCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAAGAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCATAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAAGTTCAGAGTTCTAGGAGTGGAAGAGGAGGCAACTTTGGCTTTGGGGATTCACGTGGTGGCGGTGGAAATTTCGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGATATGGCAGTGGACGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAACTTTGGTGGTAGCAGGAACATGGGGGGACCATATGGTGGAGGAAACTATGGTCCAGGAGGCAGTGGAGGAAGTGGGGGTTATGGTGGGAGGAGCCGATACTGAGCTTCTTCCTATTTGCCATGGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAATATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTTCCTTTAAAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCGTTGCAAAGCTGTTGTTATATTTGTATAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATGTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGACACAGGTCTAGTACAAGAGAACTCTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAACTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTTATTTACTTTTCCTTTCTTAATTTTCCTCCCTAAAAGATAAACTAATACTCTTAAATGGTCTTTCAGTATAGTGGTTCTTACGTAGTTTAACATAGCTATAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTTATAAACCCTGTTTTCCAATCTGTCATTTACTTAAATTATTTTGGTTGTTTTTCCCTTTTTTTCCTTCTTTTCCCACCCCCTCCCCCTCCATGTGAAGATTTGGGTGCTTAACATATCATTTTTTTCCCTGCCGGAATTTTAGCATTGATATGAACCATGGACAAGTATATTCTGCTGCCACAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGTAGGTAAAAGTTAGGCTGCAAGTTCAATAAATCATGAGATTTCCCATCGTTACACCCTTGTGTATTCACATTTCTTGGATCAAACATTTTGAGTGAACTAGGGGTTTTTATTAAAGACATTTGTTGTATTTATGGTTGTAACTGTACATGCTTATCAGGATGAGACTGAAAGAAGGTAGGGCAAAAATGGTTGAATCTATTTTCAGATAGTAGTTCATACTTGAGTGAAGTGTCTTGTCTGCATTATGAAGCCTGGTATGTATCCAGTACTAAATAGGTGGGTTAAATGTGGTAATTCTAGTTCAGTGTCTTACCCTGAAGAGAAAGTTGTAGGTTGGCTGTTGAAATTCATTCCTTAGATATGATCAGTTTGATTGCCCGGCTTTATTGCCTTTACAGGAATGTGATACTCAGGGCTTACTCTATACACCAATGAGTCTTCTTTGATCCTAAGACCACCACTGAAGTTGTTTAGGTTCTTTTGGACAAACATGATAAACTTCTTCAGATACTTTTTTTTTCCTTTGGCAGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAGTAGTTCTTGTTGGTGCCTTCATTTAAAAAGCACTCTTTAAAATAAAAGGGAAATGTTTTCTGATAAAACAAACATTTAGTTGAGGTTCTTGATATAAAACAATTACAAAATGAGTGTTGTTTGTAAAACAGTAACATCAAATTGGCTAGAGAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATTACAATTCTATTTTAAATATAAAGTTTATAAAATAAATACTTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTTCTATAAATATTTGGTTGTCTAAAAGATCACCATCCCCTAAATTTTTAAAAGCAGTTTCACAAAGCTATGCATATTTTAATATTAACAGGTAAATGAGAAGAGCATTGTGGACATTATTGGCTGTCCCCAATAAAATGCTGTTCATTATGCACTGTATATTCAGCGTTTGAGTACTCCTAAAGTTTCTGGCTTTACTTTTACGTTTAGCAATACTGGTGGCATTTTGAAAATCATGGATTTTAAAGGTTAACCGGCTGGAGTGGTCCAGATTAAGTGGCTTTGCAGAAGCACTGAGGTTTACAATATGTGCTAGATTGTCAAATGTCAATTAGTTTTATTGTGGTTTACACTGAGTAAATGAATATCAGTGTTGCTTTTTAAATGTGTTTATTTGGACATTTATCTGAATTAAGAAAACCAAAAAGACCAGGTTAATTTGTTTCTATGATAATTTGTTTTGGTTTTGATAATGTGAGGTATCTAACAGGTAAGTCAAATTTA