Transcript asmbl_26040

Sequence
Transcript Sequence for observation asmbl_26040 of TGE0000937:
GCGGAAGTCTCGTGACCCCGGAAGTGACAGGCAGGGCGGGCGGGGCGGCCGACGACGTTCGTCATTTAGTGCGGGAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGTGTCCCGACCCAGGCTAAGCTTGAGCATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCACTCGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGCCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAACGTCGTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGCGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATTGACAAGACTGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCCGTGGAGGAGGCACCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGACGACAAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGAGCCCAGCCAGAGGCGGGCAGGGCAGACTGACGGACGGACGACGGACAGGCGGATGTGTCCCCCCCAGCCCCTCCCCTCCCCATACCAAAGTGCTGACAGGCCCTCCGTGCCCCTCCCACCCTGGTCCGCCTCCCTGGCCTGGCTCAACCGAGTGCCTCCGACCCCCCTCCTCAGCCCTCCCCCACCCACAGGCCCAGCCTCCTCGGTCTCCTGTCTCGTTGCTGCTTCTGCCTGTGCTGTGGGGGAGAGAGGCCGCAGCCAGGCCTCTGCTGCCCTTTCTGTGCCCCCCAGGTTCTATCTCCCCGTCACACCCGAGGCCTGGCTTCAGGAGGGAGCGGAGCAGCCATTCTCCAGGCCCCGTGGTTGCCCCTGGACGTGTGCGTCTGCTGCTCCGGGGTGGAGCTGGGGTGTGGGATGCACGGCCTCGTGGGGGCCGGGCCGTCCTCCAGCCCCGCTGCTCCCTGGCCAGCCCCCTTGTCGCTGTCGGTCCCGTCTAACCATGATGCCTTAACATGTGGAGTGTACCGTGGGGCCTCACTAGCCTCTAACTCCCTGTGTCTGCATGAGCATGTGGCCTCCCCGTCCCTTCCCCGGTGGCGAACCCAGTGACCCAGGGACACGTGGGGTGTGCTGCTGCTGCTCCCCAGCCCACCAGTGCCTGGCCAGCCTGCCCCCTTCCCTGGACAGGGCTGTGGAGATGGCTCCGGCGGCTTGGGGAAAGCCAAATTGCCAAAACTCAAGTCACCTCAGTACCATCCAGGAGGCTGGGTATTGTCCTGCCTCTGCCTTTTCTGTCTCAGCGGGCAGTGCCCAGAGCCCACACCCCCCCAAGAGCCCTCGATGGACAGCCTCACTCACCCCACCTGGGCCCAGCCAGGAGCCCCGCCTGGCCATCAGTATTTATTGCCTCCGTCCGTGCCGTCCCTGGGCCACTGGCCTGGCGCCTGTTCCCCCAGGCTCTCAGTGCCACCACCCCCGGCAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACATTGCTGAGAGCCGTCTCCTGTGCCTCCCCCGCCCCATCCCCGGTCTTCGTGTTGTGTCTGCCAGGCTCAGGCAGAGGCGCCTGTCCCTGCTTCTTTTCTGACCGGGAAATAAATGCCCCTGAAGGAG