Transcript asmbl_119188

Sequence
Transcript Sequence for observation asmbl_119188 of TGE0057622:
CACGTTCTCCAGGAACACCTTCAGAACACCACGAGTCTCCTCATAGATAAGGCCAGAAATTCGCTTGACACCGCCGCGACGAGCAAGGCGCCGGATAGCTGGCTTAGTGATGCCCTGGATGTTATCGCGCAAAACCTTGCGATGACGCTTAGCTCCTCCCTTACCCAAACCTTTTCCACCTTTACCACGGCCAGACATGACTAAGCAACTTCTAAAACCAACTTAAGAAACCTAAAC